Incidental Mutation 'R1014:Arg1'
ID96024
Institutional Source Beutler Lab
Gene Symbol Arg1
Ensembl Gene ENSMUSG00000019987
Gene Namearginase, liver
SynonymsPGIF, AI, Arg-1
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24915221-24927484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24916860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 159 (V159L)
Ref Sequence ENSEMBL: ENSMUSP00000020161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000020161] [ENSMUST00000092646] [ENSMUST00000176285]
Predicted Effect probably benign
Transcript: ENSMUST00000020159
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020161
AA Change: V159L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020161
Gene: ENSMUSG00000019987
AA Change: V159L

DomainStartEndE-ValueType
Pfam:Arginase 6 305 1.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092646
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176285
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218260
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exist (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type I isoform encoded by this gene, is a cytosolic enzyme and expressed predominantly in the liver as a component of the urea cycle. Inherited deficiency of this enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a null allele show postnatal lethality, hyperammonemia, argininemia, altered plasma levels of other amino acids, enlarged pale livers, and abnormal hepatocytes. Mice homozygous for a different null allele show postnatal lethality, andincreased macrophage nitric oxide production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Arg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02011:Arg1 APN 10 24916377 missense probably benign 0.00
IGL02889:Arg1 APN 10 24915755 missense probably damaging 0.98
R0180:Arg1 UTSW 10 24916830 missense probably benign
R0256:Arg1 UTSW 10 24916458 missense probably benign 0.00
R0588:Arg1 UTSW 10 24920624 missense probably damaging 1.00
R1327:Arg1 UTSW 10 24920804 splice site probably null
R1965:Arg1 UTSW 10 24916864 splice site probably null
R2071:Arg1 UTSW 10 24922663 missense probably benign 0.00
R2118:Arg1 UTSW 10 24920723 missense possibly damaging 0.58
R4158:Arg1 UTSW 10 24922677 missense probably damaging 1.00
R4858:Arg1 UTSW 10 24922638 missense possibly damaging 0.73
R5741:Arg1 UTSW 10 24917999 missense probably benign
R5793:Arg1 UTSW 10 24920642 missense probably benign 0.36
R7453:Arg1 UTSW 10 24915776 missense probably damaging 1.00
R7634:Arg1 UTSW 10 24915729 missense possibly damaging 0.46
R7760:Arg1 UTSW 10 24927463 start gained probably benign
R7803:Arg1 UTSW 10 24916791 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTGAAGGTCTCTTCCATCACCTTG -3'
(R):5'- CTGGGAAGCACTTATCGGAACCAC -3'

Sequencing Primer
(F):5'- GATCACTGTAAGTCCTGTGAACTG -3'
(R):5'- CACTTATCGGAACCACAGGAG -3'
Posted On2014-01-05