Incidental Mutation 'R1014:Poldip2'
ID96028
Institutional Source Beutler Lab
Gene Symbol Poldip2
Ensembl Gene ENSMUSG00000001100
Gene Namepolymerase (DNA-directed), delta interacting protein 2
Synonymsmitogenin 1, 1300003F06Rik
MMRRC Submission 039118-MU
Accession Numbers

Genbank: NM_026389; MGI: 1915061

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78512193-78522736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78515162 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 106 (D106E)
Ref Sequence ENSEMBL: ENSMUSP00000001127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001127] [ENSMUST00000052566]
Predicted Effect probably damaging
Transcript: ENSMUST00000001127
AA Change: D106E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001127
Gene: ENSMUSG00000001100
AA Change: D106E

DomainStartEndE-ValueType
low complexity region 29 47 N/A INTRINSIC
YccV-like 74 210 1.03e-39 SMART
Pfam:DUF525 252 338 2.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052566
SMART Domains Protein: ENSMUSP00000058599
Gene: ENSMUSG00000051232

DomainStartEndE-ValueType
Pfam:Vma12 78 204 1e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133601
AA Change: D71E
SMART Domains Protein: ENSMUSP00000127708
Gene: ENSMUSG00000001100
AA Change: D71E

DomainStartEndE-ValueType
YccV-like 40 176 1.03e-39 SMART
Pfam:DUF525 218 278 4.9e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156754
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the DNA polymerase delta p50 subunit, as well as with proliferating cell nuclear antigen. The encoded protein maybe play a role in the ability of the replication fork to bypass DNA lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality and decreased body size. Mice heterozygous for this allele exhibit abnormal induced vasoconstriction and vasodilation with abnormal aorta elastic tissue morphology. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Poldip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Poldip2 APN 11 78512307 unclassified probably benign
IGL02119:Poldip2 APN 11 78517908 missense probably damaging 1.00
IGL02565:Poldip2 APN 11 78517852 missense probably damaging 1.00
IGL02735:Poldip2 APN 11 78512336 missense probably benign 0.04
IGL03115:Poldip2 APN 11 78521144 splice site probably benign
F6893:Poldip2 UTSW 11 78519194 missense probably damaging 1.00
IGL02980:Poldip2 UTSW 11 78521228 missense probably damaging 1.00
R0255:Poldip2 UTSW 11 78512363 missense probably benign 0.02
R0932:Poldip2 UTSW 11 78512468 missense possibly damaging 0.52
R4797:Poldip2 UTSW 11 78513987 missense probably damaging 1.00
R5505:Poldip2 UTSW 11 78515175 missense probably benign
R6285:Poldip2 UTSW 11 78517632 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTGTAGTTGCTTCTACCCAGG -3'
(R):5'- GAGACCCCATAGCACTTTTGTCTCC -3'

Sequencing Primer
(F):5'- TCTACCCAGGCCGCTATG -3'
(R):5'- gaccctcctgtttctgcc -3'
Posted On2014-01-05