Incidental Mutation 'R1125:Necab1'
ID96031
Institutional Source Beutler Lab
Gene Symbol Necab1
Ensembl Gene ENSMUSG00000040536
Gene NameN-terminal EF-hand calcium binding protein 1
Synonyms1700003H21Rik, Efcbp1, NECAB1, STIP-1
MMRRC Submission 039198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1125 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location14952245-15149794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15111257 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 57 (D57V)
Ref Sequence ENSEMBL: ENSMUSP00000103908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041606] [ENSMUST00000108273]
Predicted Effect probably damaging
Transcript: ENSMUST00000041606
AA Change: D57V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038165
Gene: ENSMUSG00000040536
AA Change: D57V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108273
AA Change: D57V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103908
Gene: ENSMUSG00000040536
AA Change: D57V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
EFh 30 58 4.06e-2 SMART
EFh 64 92 6.56e0 SMART
coiled coil region 135 163 N/A INTRINSIC
coiled coil region 209 244 N/A INTRINSIC
Pfam:ABM 251 326 2.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141105
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,978 I254T probably benign Het
Abcb5 T C 12: 118,911,547 D630G possibly damaging Het
Anks4b T G 7: 120,182,357 F204V possibly damaging Het
C87436 T C 6: 86,447,362 V282A probably benign Het
Cav3 T A 6: 112,472,296 F92I probably damaging Het
Cbs A T 17: 31,632,831 V66E probably benign Het
Cd226 A G 18: 89,267,922 I172V probably benign Het
Ctns C A 11: 73,187,837 probably null Het
Fam166b A G 4: 43,427,550 I258T probably damaging Het
Gid4 A G 11: 60,424,781 D66G possibly damaging Het
Glra3 A G 8: 56,039,754 D163G possibly damaging Het
Lrrc23 A G 6: 124,776,182 V167A probably benign Het
Nbea A T 3: 55,857,006 L1979* probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr693 T A 7: 106,678,007 T160S possibly damaging Het
Plekhd1 C A 12: 80,707,224 Q155K possibly damaging Het
Ppara A G 15: 85,789,055 N149S possibly damaging Het
Slc30a5 C T 13: 100,803,413 V665M probably damaging Het
Sntb1 T G 15: 55,749,280 T301P probably benign Het
Tlr5 A T 1: 182,973,892 T240S probably benign Het
Ttc5 A G 14: 50,777,878 L92P probably damaging Het
Ttll10 A G 4: 156,035,038 S664P possibly damaging Het
Uhrf1bp1 T C 17: 27,893,449 V1204A probably damaging Het
Vmn2r45 G A 7: 8,485,543 R163C probably benign Het
Vmn2r94 T C 17: 18,257,455 I231M probably damaging Het
Other mutations in Necab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Necab1 APN 4 15052656 missense probably damaging 1.00
IGL01314:Necab1 APN 4 15005079 missense probably damaging 0.96
IGL01751:Necab1 APN 4 14978171 missense probably damaging 1.00
IGL02098:Necab1 APN 4 14955892 utr 3 prime probably benign
IGL02381:Necab1 APN 4 15148812 splice site probably null
IGL03247:Necab1 APN 4 14960046 missense probably benign
R0095:Necab1 UTSW 4 14960027 missense possibly damaging 0.95
R0095:Necab1 UTSW 4 14960027 missense possibly damaging 0.95
R0321:Necab1 UTSW 4 14960083 missense probably damaging 0.99
R0698:Necab1 UTSW 4 15005041 missense probably benign 0.26
R1251:Necab1 UTSW 4 15111192 critical splice donor site probably null
R1400:Necab1 UTSW 4 14975185 missense possibly damaging 0.71
R1505:Necab1 UTSW 4 14960047 missense probably benign 0.26
R1771:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R1776:Necab1 UTSW 4 15111267 missense probably damaging 1.00
R2080:Necab1 UTSW 4 15140219 splice site probably benign
R4705:Necab1 UTSW 4 15052628 missense probably damaging 1.00
R4780:Necab1 UTSW 4 14989248 missense probably benign 0.18
R4795:Necab1 UTSW 4 15111208 missense possibly damaging 0.84
R4972:Necab1 UTSW 4 14978216 missense probably damaging 1.00
R5009:Necab1 UTSW 4 14947503 unclassified probably benign
R6102:Necab1 UTSW 4 14989211 missense probably benign 0.05
R6968:Necab1 UTSW 4 14957852 missense probably damaging 1.00
R7458:Necab1 UTSW 4 15111244 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACCCTAAACAAGCAGTGCATCTCTG -3'
(R):5'- AGGCCATACACCAGTGCATGTTTC -3'

Sequencing Primer
(F):5'- GGTATCCACATGCCAAGTAAATG -3'
(R):5'- GACATTGCAAAGGTTTCCTTCTTG -3'
Posted On2014-01-05