Incidental Mutation 'R1014:Pck2'
ID96038
Institutional Source Beutler Lab
Gene Symbol Pck2
Ensembl Gene ENSMUSG00000040618
Gene Namephosphoenolpyruvate carboxykinase 2 (mitochondrial)
Synonyms1810010O14Rik, 9130022B02Rik
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55540266-55551242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55542410 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 12 (S12G)
Ref Sequence ENSEMBL: ENSMUSP00000154762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048781] [ENSMUST00000226352] [ENSMUST00000226519] [ENSMUST00000228240]
Predicted Effect probably benign
Transcript: ENSMUST00000048781
AA Change: S39G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038555
Gene: ENSMUSG00000040618
AA Change: S39G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:PEPCK 73 664 1.9e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226295
Predicted Effect probably benign
Transcript: ENSMUST00000226352
AA Change: S12G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226514
Predicted Effect probably benign
Transcript: ENSMUST00000226519
AA Change: S12G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000226650
AA Change: S2G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226770
Predicted Effect probably benign
Transcript: ENSMUST00000228240
AA Change: S4G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228843
Predicted Effect unknown
Transcript: ENSMUST00000228921
AA Change: S2G
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of guanosine triphosphate (GTP). A cytosolic form of this protein is encoded by a different gene and is the key enzyme of gluconeogenesis in the liver. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Pck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pck2 APN 14 55542641 missense probably benign 0.30
IGL00430:Pck2 APN 14 55543944 missense probably benign 0.07
IGL00814:Pck2 APN 14 55548299 unclassified probably benign
IGL01012:Pck2 APN 14 55544069 splice site probably benign
IGL02095:Pck2 APN 14 55542510 missense probably benign 0.02
IGL02227:Pck2 APN 14 55543866 missense probably benign
IGL02435:Pck2 APN 14 55544390 splice site probably benign
IGL03124:Pck2 APN 14 55545333 missense probably damaging 1.00
R0271:Pck2 UTSW 14 55544584 critical splice donor site probably null
R1116:Pck2 UTSW 14 55545366 missense probably benign 0.00
R1640:Pck2 UTSW 14 55548584 missense possibly damaging 0.51
R1793:Pck2 UTSW 14 55543965 missense possibly damaging 0.81
R1965:Pck2 UTSW 14 55542507 missense probably benign 0.07
R1983:Pck2 UTSW 14 55544068 splice site probably null
R3196:Pck2 UTSW 14 55543992 missense probably damaging 1.00
R4751:Pck2 UTSW 14 55542561 missense probably damaging 1.00
R5385:Pck2 UTSW 14 55545231 missense probably damaging 1.00
R5960:Pck2 UTSW 14 55548547 missense possibly damaging 0.48
R6134:Pck2 UTSW 14 55543962 missense probably damaging 1.00
R6276:Pck2 UTSW 14 55542624 missense probably damaging 1.00
R7030:Pck2 UTSW 14 55547766 missense probably damaging 1.00
R7199:Pck2 UTSW 14 55548712 missense probably benign 0.43
R7516:Pck2 UTSW 14 55542456 missense probably benign 0.00
R8066:Pck2 UTSW 14 55544401 missense probably benign 0.30
X0065:Pck2 UTSW 14 55548063 missense probably benign 0.01
Z1176:Pck2 UTSW 14 55545269 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACTCTTGGACCAGAGGCTTGAC -3'
(R):5'- TGTTCTTCCAGCAGGGCCAGTATG -3'

Sequencing Primer
(F):5'- GATACAGGTAGTCTGAACTCACTC -3'
(R):5'- CCAGTATGGCAGTGTTCTCAG -3'
Posted On2014-01-05