Incidental Mutation 'R1125:Ttll10'
ID96039
Institutional Source Beutler Lab
Gene Symbol Ttll10
Ensembl Gene ENSMUSG00000029074
Gene Nametubulin tyrosine ligase-like family, member 10
Synonyms4930595O22Rik, Ttll5, 4833412E22Rik
MMRRC Submission 039198-MU
Accession Numbers

Genbank: NM_029264; MGI: 1921855

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1125 (G1)
Quality Score165
Status Not validated
Chromosome4
Chromosomal Location156034840-156059414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156035038 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 664 (S664P)
Ref Sequence ENSEMBL: ENSMUSP00000139316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051509] [ENSMUST00000184348] [ENSMUST00000184684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051509
AA Change: S635P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055671
Gene: ENSMUSG00000029074
AA Change: S635P

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
low complexity region 63 73 N/A INTRINSIC
low complexity region 104 118 N/A INTRINSIC
Pfam:TTL 189 507 1.8e-48 PFAM
low complexity region 541 583 N/A INTRINSIC
low complexity region 587 600 N/A INTRINSIC
low complexity region 622 638 N/A INTRINSIC
low complexity region 652 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151836
Predicted Effect possibly damaging
Transcript: ENSMUST00000184348
AA Change: S664P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139316
Gene: ENSMUSG00000029074
AA Change: S664P

DomainStartEndE-ValueType
low complexity region 92 102 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:TTL 218 536 7.9e-48 PFAM
low complexity region 570 612 N/A INTRINSIC
low complexity region 616 629 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 681 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184684
SMART Domains Protein: ENSMUSP00000139077
Gene: ENSMUSG00000029074

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
Pfam:TTL 100 418 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184750
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,978 I254T probably benign Het
Abcb5 T C 12: 118,911,547 D630G possibly damaging Het
Anks4b T G 7: 120,182,357 F204V possibly damaging Het
C87436 T C 6: 86,447,362 V282A probably benign Het
Cav3 T A 6: 112,472,296 F92I probably damaging Het
Cbs A T 17: 31,632,831 V66E probably benign Het
Cd226 A G 18: 89,267,922 I172V probably benign Het
Ctns C A 11: 73,187,837 probably null Het
Fam166b A G 4: 43,427,550 I258T probably damaging Het
Gid4 A G 11: 60,424,781 D66G possibly damaging Het
Glra3 A G 8: 56,039,754 D163G possibly damaging Het
Lrrc23 A G 6: 124,776,182 V167A probably benign Het
Nbea A T 3: 55,857,006 L1979* probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Necab1 T A 4: 15,111,257 D57V probably damaging Het
Olfr693 T A 7: 106,678,007 T160S possibly damaging Het
Plekhd1 C A 12: 80,707,224 Q155K possibly damaging Het
Ppara A G 15: 85,789,055 N149S possibly damaging Het
Slc30a5 C T 13: 100,803,413 V665M probably damaging Het
Sntb1 T G 15: 55,749,280 T301P probably benign Het
Tlr5 A T 1: 182,973,892 T240S probably benign Het
Ttc5 A G 14: 50,777,878 L92P probably damaging Het
Uhrf1bp1 T C 17: 27,893,449 V1204A probably damaging Het
Vmn2r45 G A 7: 8,485,543 R163C probably benign Het
Vmn2r94 T C 17: 18,257,455 I231M probably damaging Het
Other mutations in Ttll10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ttll10 APN 4 156046894 missense probably benign 0.09
IGL02109:Ttll10 APN 4 156047480 missense probably benign
IGL02121:Ttll10 APN 4 156048433 missense probably benign 0.04
F6893:Ttll10 UTSW 4 156048318 missense probably benign 0.00
R0366:Ttll10 UTSW 4 156035155 missense probably damaging 0.97
R0502:Ttll10 UTSW 4 156047548 splice site probably benign
R0503:Ttll10 UTSW 4 156047548 splice site probably benign
R0523:Ttll10 UTSW 4 156045361 nonsense probably null
R0865:Ttll10 UTSW 4 156043678 missense probably damaging 1.00
R0907:Ttll10 UTSW 4 156036164 nonsense probably null
R1555:Ttll10 UTSW 4 156035139 missense probably benign 0.00
R1797:Ttll10 UTSW 4 156047567 missense probably damaging 0.96
R3899:Ttll10 UTSW 4 156035800 missense probably damaging 1.00
R4426:Ttll10 UTSW 4 156048561 missense possibly damaging 0.55
R5715:Ttll10 UTSW 4 156045391 missense probably damaging 1.00
R5762:Ttll10 UTSW 4 156034981 missense possibly damaging 0.93
R5814:Ttll10 UTSW 4 156047627 missense possibly damaging 0.51
R5958:Ttll10 UTSW 4 156036066 intron probably null
R5994:Ttll10 UTSW 4 156048732 intron probably null
R6084:Ttll10 UTSW 4 156045357 missense probably benign 0.34
R7027:Ttll10 UTSW 4 156035801 missense possibly damaging 0.70
R8010:Ttll10 UTSW 4 156047161 missense not run
Z1176:Ttll10 UTSW 4 156048517 missense not run
Z1177:Ttll10 UTSW 4 156047438 missense not run
Predicted Primers PCR Primer
(F):5'- TTTTATAGGTCCCGGAGAGGGCAC -3'
(R):5'- AAGATGCTGCCTCTGCTGTCAC -3'

Sequencing Primer
(F):5'- CACAGCAAGGTGCAGGG -3'
(R):5'- cctaaccctcaccctaaccc -3'
Posted On2014-01-05