Incidental Mutation 'R1014:Nadk2'
ID96044
Institutional Source Beutler Lab
Gene Symbol Nadk2
Ensembl Gene ENSMUSG00000022253
Gene NameNAD kinase 2, mitochondrial
Synonyms4933430B08Rik, 1110020G09Rik, MNADK, Nadkd1
MMRRC Submission 039118-MU
Accession Numbers

Genbank: NM_001040395; MGI: 1915896

 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9071260-9110891 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9091254 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 202 (F202L)
Ref Sequence ENSEMBL: ENSMUSP00000098354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067760] [ENSMUST00000100789] [ENSMUST00000100790]
Predicted Effect probably damaging
Transcript: ENSMUST00000067760
AA Change: F202L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068318
Gene: ENSMUSG00000022253
AA Change: F202L

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 334 4.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100789
SMART Domains Protein: ENSMUSP00000098353
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 171 8.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100790
AA Change: F202L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098354
Gene: ENSMUSG00000022253
AA Change: F202L

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 312 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228453
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial kinase that catalyzes the phosphorylation of NAD to yield NADP. Mutations in this gene result in 2,4-dienoyl-CoA reductase deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for knock-out allele exhibit increased serum lysine and carnitine levels, develop increased reactive oxygen species levels and hepatic steatosis on an atherogenic high-fat diet, and show impaired fasting-induced fatty acid oxidation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Nadk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Nadk2 APN 15 9102984 missense probably damaging 1.00
tabak UTSW 15 9108254 missense probably damaging 0.99
PIT4131001:Nadk2 UTSW 15 9100143 frame shift probably null
PIT4142001:Nadk2 UTSW 15 9100143 frame shift probably null
R0347:Nadk2 UTSW 15 9084207 missense probably benign 0.08
R0838:Nadk2 UTSW 15 9091242 missense probably benign 0.00
R0988:Nadk2 UTSW 15 9102992 missense probably damaging 0.99
R1159:Nadk2 UTSW 15 9106837 missense possibly damaging 0.86
R1387:Nadk2 UTSW 15 9106782 missense possibly damaging 0.68
R1861:Nadk2 UTSW 15 9108311 missense probably benign 0.21
R1886:Nadk2 UTSW 15 9103358 missense possibly damaging 0.87
R2354:Nadk2 UTSW 15 9085782 missense probably damaging 1.00
R3623:Nadk2 UTSW 15 9084223 missense probably damaging 1.00
R3624:Nadk2 UTSW 15 9084223 missense probably damaging 1.00
R4642:Nadk2 UTSW 15 9092721 missense possibly damaging 0.64
R4867:Nadk2 UTSW 15 9098857 missense possibly damaging 0.84
R5314:Nadk2 UTSW 15 9108313 missense probably benign 0.04
R7214:Nadk2 UTSW 15 9108254 missense probably damaging 0.99
R7244:Nadk2 UTSW 15 9083191 splice site probably null
R7310:Nadk2 UTSW 15 9103381 critical splice donor site probably null
R7634:Nadk2 UTSW 15 9092846 missense probably benign 0.41
R8310:Nadk2 UTSW 15 9103332 missense probably benign
R8424:Nadk2 UTSW 15 9083334 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACGTATTAAGGCTGACTGTGGACC -3'
(R):5'- GCCAAGTAACATTTGTCCCGTCCTC -3'

Sequencing Primer
(F):5'- TTGAAAGTACAGACAATTCCAGGC -3'
(R):5'- TAGTTCTAACTGAACTAGGAGAAGG -3'
Posted On2014-01-05