Incidental Mutation 'R1014:Slc30a8'
ID96048
Institutional Source Beutler Lab
Gene Symbol Slc30a8
Ensembl Gene ENSMUSG00000022315
Gene Namesolute carrier family 30 (zinc transporter), member 8
SynonymsZnT-8, C820002P14Rik, ZnT8
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location52295553-52335798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52331597 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 251 (T251A)
Ref Sequence ENSEMBL: ENSMUSP00000035257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037240]
Predicted Effect probably damaging
Transcript: ENSMUST00000037240
AA Change: T251A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035257
Gene: ENSMUSG00000022315
AA Change: T251A

DomainStartEndE-ValueType
Pfam:Cation_efflux 73 274 6.7e-47 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc efflux transporter involved in the accumulation of zinc in intracellular vesicles. This gene is expressed at a high level only in the pancreas, particularly in islets of Langerhans. The encoded protein colocalizes with insulin in the secretory pathway granules of the insulin-secreting INS-1 cells. Allelic variants of this gene exist that confer susceptibility to diabetes mellitus, noninsulin-dependent (NIDDM). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced islet zinc levels, circulating insulin levels, and glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Slc30a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Slc30a8 APN 15 52306559 missense possibly damaging 0.47
IGL01823:Slc30a8 APN 15 52295962 splice site probably benign
IGL01988:Slc30a8 APN 15 52335205 missense probably benign 0.00
IGL02517:Slc30a8 APN 15 52335134 missense probably benign 0.34
IGL03376:Slc30a8 APN 15 52306457 nonsense probably null
R0480:Slc30a8 UTSW 15 52325570 missense probably benign
R1725:Slc30a8 UTSW 15 52333604 missense possibly damaging 0.93
R1827:Slc30a8 UTSW 15 52331557 splice site probably null
R2126:Slc30a8 UTSW 15 52295934 missense probably benign 0.00
R2232:Slc30a8 UTSW 15 52306564 missense probably benign 0.00
R3911:Slc30a8 UTSW 15 52321701 missense probably benign 0.22
R4613:Slc30a8 UTSW 15 52333575 missense probably benign 0.02
R4820:Slc30a8 UTSW 15 52306484 missense probably benign 0.00
R5790:Slc30a8 UTSW 15 52333647 missense possibly damaging 0.46
R6020:Slc30a8 UTSW 15 52325658 missense probably damaging 1.00
R6125:Slc30a8 UTSW 15 52335134 missense probably benign 0.15
R6250:Slc30a8 UTSW 15 52335149 missense probably benign 0.22
R6701:Slc30a8 UTSW 15 52331574 missense possibly damaging 0.84
R7227:Slc30a8 UTSW 15 52331636 missense probably benign 0.00
R7313:Slc30a8 UTSW 15 52317311 missense probably damaging 1.00
R7997:Slc30a8 UTSW 15 52325685 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACACCCAGGGTCAGGAAGATCAATG -3'
(R):5'- CCCCGTGTGCTTGTACTTTGAGAC -3'

Sequencing Primer
(F):5'- TCAGGAAGATCAATGAGTGGC -3'
(R):5'- tgtgtgtgtgtATTTCTATTAGTTCC -3'
Posted On2014-01-05