Mutagenetix > Incidental Mutation

Incidental Mutation 'R1125:Vmn2r45'

96051

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r45

Ensembl Gene

ENSMUSG00000090662

Gene Name

vomeronasal 2, receptor 45

Synonyms

MMRRC Submission

039198-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R1125 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8470525-8489075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 8485543 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 163 (R163C)

Ref Sequence

ENSEMBL: ENSMUSP00000129466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164845]

AlphaFold

L7N2B5

Predicted Effect

probably benign
Transcript: ENSMUST00000164845
AA Change: R163C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000129466
Gene: ENSMUSG00000090662
AA Change: R163C

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	154	469	4.5e-26	PFAM
Pfam:NCD3G	512	565	6.4e-21	PFAM
Pfam:7tm_3	598	833	2.1e-54	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	T	C	19: 31,920,978	I254T	probably benign	Het
Abcb5	T	C	12: 118,911,547	D630G	possibly damaging	Het
Anks4b	T	G	7: 120,182,357	F204V	possibly damaging	Het
C87436	T	C	6: 86,447,362	V282A	probably benign	Het
Cav3	T	A	6: 112,472,296	F92I	probably damaging	Het
Cbs	A	T	17: 31,632,831	V66E	probably benign	Het
Cd226	A	G	18: 89,267,922	I172V	probably benign	Het
Ctns	C	A	11: 73,187,837		probably null	Het
Fam166b	A	G	4: 43,427,550	I258T	probably damaging	Het
Gid4	A	G	11: 60,424,781	D66G	possibly damaging	Het
Glra3	A	G	8: 56,039,754	D163G	possibly damaging	Het
Lrrc23	A	G	6: 124,776,182	V167A	probably benign	Het
Nbea	A	T	3: 55,857,006	L1979*	probably null	Het
Nckap1	C	T	2: 80,517,942	S889N	probably benign	Het
Necab1	T	A	4: 15,111,257	D57V	probably damaging	Het
Olfr693	T	A	7: 106,678,007	T160S	possibly damaging	Het
Plekhd1	C	A	12: 80,707,224	Q155K	possibly damaging	Het
Ppara	A	G	15: 85,789,055	N149S	possibly damaging	Het
Slc30a5	C	T	13: 100,803,413	V665M	probably damaging	Het
Sntb1	T	G	15: 55,749,280	T301P	probably benign	Het
Tlr5	A	T	1: 182,973,892	T240S	probably benign	Het
Ttc5	A	G	14: 50,777,878	L92P	probably damaging	Het
Ttll10	A	G	4: 156,035,038	S664P	possibly damaging	Het
Uhrf1bp1	T	C	17: 27,893,449	V1204A	probably damaging	Het
Vmn2r94	T	C	17: 18,257,455	I231M	probably damaging	Het

Other mutations in Vmn2r45

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01287:Vmn2r45	APN	7	8485623	missense	probably benign	0.00
IGL01322:Vmn2r45	APN	7	8481333	missense	possibly damaging	0.49
IGL01402:Vmn2r45	APN	7	8481468	missense	probably damaging	0.98
IGL01404:Vmn2r45	APN	7	8481468	missense	probably damaging	0.98
IGL01529:Vmn2r45	APN	7	8483494	missense	probably benign
IGL01596:Vmn2r45	APN	7	8483273	missense	probably damaging	0.98
IGL01646:Vmn2r45	APN	7	8483338	missense	probably benign	0.18
IGL01819:Vmn2r45	APN	7	8485557	missense	probably benign	0.00
IGL02096:Vmn2r45	APN	7	8481444	missense	probably damaging	0.99
IGL02130:Vmn2r45	APN	7	8483557	missense	possibly damaging	0.46
IGL02409:Vmn2r45	APN	7	8485728	missense	probably benign	0.03
IGL02517:Vmn2r45	APN	7	8483186	nonsense	probably null
IGL02633:Vmn2r45	APN	7	8485729	missense	probably benign	0.01
IGL02940:Vmn2r45	APN	7	8472370	missense	probably damaging	0.99
IGL03281:Vmn2r45	APN	7	8483604	missense	probably damaging	1.00
IGL03358:Vmn2r45	APN	7	8471716	missense	probably damaging	1.00
BB004:Vmn2r45	UTSW	7	8483514	missense	probably benign
BB014:Vmn2r45	UTSW	7	8483514	missense	probably benign
R0382:Vmn2r45	UTSW	7	8483099	missense	probably benign	0.06
R0532:Vmn2r45	UTSW	7	8471821	missense	probably damaging	0.99
R0932:Vmn2r45	UTSW	7	8475381	missense	probably damaging	1.00
R1580:Vmn2r45	UTSW	7	8471747	missense	possibly damaging	0.95
R1817:Vmn2r45	UTSW	7	8472373	missense	probably damaging	1.00
R1996:Vmn2r45	UTSW	7	8472025	missense	probably damaging	1.00
R2050:Vmn2r45	UTSW	7	8472022	missense	probably damaging	1.00
R2284:Vmn2r45	UTSW	7	8485766	missense	probably benign	0.02
R4019:Vmn2r45	UTSW	7	8471581	nonsense	probably null
R4227:Vmn2r45	UTSW	7	8483278	missense	probably damaging	0.98
R4381:Vmn2r45	UTSW	7	8471913	nonsense	probably null
R4618:Vmn2r45	UTSW	7	8483437	missense	probably benign	0.00
R4624:Vmn2r45	UTSW	7	8481342	missense	probably damaging	1.00
R4704:Vmn2r45	UTSW	7	8483536	nonsense	probably null
R4735:Vmn2r45	UTSW	7	8483473	missense	probably damaging	1.00
R4868:Vmn2r45	UTSW	7	8481481	missense	probably benign	0.06
R4983:Vmn2r45	UTSW	7	8483117	missense	probably damaging	0.99
R5246:Vmn2r45	UTSW	7	8483252	missense	probably benign	0.00
R5430:Vmn2r45	UTSW	7	8483334	nonsense	probably null
R5504:Vmn2r45	UTSW	7	8483177	missense	probably benign	0.03
R5511:Vmn2r45	UTSW	7	8471833	missense	probably benign	0.19
R5745:Vmn2r45	UTSW	7	8483075	missense	probably benign	0.00
R5814:Vmn2r45	UTSW	7	8471476	missense	probably benign	0.00
R6223:Vmn2r45	UTSW	7	8483302	missense	probably benign
R6267:Vmn2r45	UTSW	7	8472208	missense	probably benign	0.26
R6623:Vmn2r45	UTSW	7	8471501	missense	probably benign	0.09
R6999:Vmn2r45	UTSW	7	8483220	missense	probably benign
R7242:Vmn2r45	UTSW	7	8485613	nonsense	probably null
R7491:Vmn2r45	UTSW	7	8481343	missense	probably benign	0.27
R7620:Vmn2r45	UTSW	7	8483223	nonsense	probably null
R7719:Vmn2r45	UTSW	7	8483461	missense	probably damaging	0.99
R7720:Vmn2r45	UTSW	7	8483461	missense	probably damaging	0.99
R7853:Vmn2r45	UTSW	7	8482988	missense	possibly damaging	0.90
R7873:Vmn2r45	UTSW	7	8483075	missense	probably benign	0.00
R7882:Vmn2r45	UTSW	7	8483410	missense	possibly damaging	0.82
R7927:Vmn2r45	UTSW	7	8483514	missense	probably benign
R8684:Vmn2r45	UTSW	7	8483512	missense	probably damaging	0.99
R8780:Vmn2r45	UTSW	7	8481372	missense	possibly damaging	0.94
R8811:Vmn2r45	UTSW	7	8471882	missense	probably damaging	1.00
R8893:Vmn2r45	UTSW	7	8485620	missense	probably damaging	1.00
R9043:Vmn2r45	UTSW	7	8471905	missense	possibly damaging	0.92
R9208:Vmn2r45	UTSW	7	8483299	missense	probably damaging	1.00
R9327:Vmn2r45	UTSW	7	8471533	missense	probably damaging	1.00
R9586:Vmn2r45	UTSW	7	8483051	missense	probably benign	0.01
R9599:Vmn2r45	UTSW	7	8475458	critical splice acceptor site	probably null
U24488:Vmn2r45	UTSW	7	8472362	missense	probably damaging	1.00
Z1088:Vmn2r45	UTSW	7	8471485	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CTTGTGGTAGCCGTTAGCAGAAGG -3'
(R):5'- TTGTAACAAAAGCCATTTGTTCCCGTC -3'

Sequencing Primer
(F):5'- CCTGGGACTACCTAGATTGACA -3'
(R):5'- CCGTCTTTAGATGTCAGATTCAG -3'

Posted On

2014-01-05