Incidental Mutation 'R1014:Spryd3'
ID96052
Institutional Source Beutler Lab
Gene Symbol Spryd3
Ensembl Gene ENSMUSG00000036966
Gene NameSPRY domain containing 3
Synonyms
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102116528-102136234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102133531 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 19 (N19Y)
Ref Sequence ENSEMBL: ENSMUSP00000121493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000154032]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139279
Predicted Effect probably damaging
Transcript: ENSMUST00000154032
AA Change: N19Y

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121493
Gene: ENSMUSG00000036966
AA Change: N19Y

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
SPRY 76 201 1.66e-11 SMART
SPRY 256 441 3.28e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156475
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Spryd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Spryd3 APN 15 102130276 critical splice donor site probably null
IGL02138:Spryd3 APN 15 102118919 unclassified probably benign
IGL02652:Spryd3 APN 15 102118990 splice site probably null
IGL02716:Spryd3 APN 15 102133461 missense possibly damaging 0.91
IGL02949:Spryd3 APN 15 102118109 missense probably benign 0.03
B6819:Spryd3 UTSW 15 102118141 missense probably benign 0.01
BB001:Spryd3 UTSW 15 102118327 missense probably benign 0.18
BB011:Spryd3 UTSW 15 102118327 missense probably benign 0.18
K7894:Spryd3 UTSW 15 102118141 missense probably benign 0.01
R0111:Spryd3 UTSW 15 102128537 critical splice donor site probably null
R0479:Spryd3 UTSW 15 102130400 nonsense probably null
R0654:Spryd3 UTSW 15 102128534 splice site probably null
R1448:Spryd3 UTSW 15 102118392 missense possibly damaging 0.93
R1510:Spryd3 UTSW 15 102118961 missense probably damaging 0.99
R1863:Spryd3 UTSW 15 102117659 missense probably benign 0.17
R2069:Spryd3 UTSW 15 102118181 missense probably benign 0.01
R2212:Spryd3 UTSW 15 102130276 critical splice donor site probably null
R4581:Spryd3 UTSW 15 102130364 missense probably damaging 0.98
R4892:Spryd3 UTSW 15 102118102 missense probably benign 0.02
R5068:Spryd3 UTSW 15 102128611 missense probably benign 0.02
R5586:Spryd3 UTSW 15 102131937 missense probably benign
R5771:Spryd3 UTSW 15 102116907 unclassified probably benign
R5945:Spryd3 UTSW 15 102118195 missense probably benign 0.22
R7080:Spryd3 UTSW 15 102118192 missense probably benign 0.04
R7816:Spryd3 UTSW 15 102117706 missense probably damaging 0.99
R7924:Spryd3 UTSW 15 102118327 missense probably benign 0.18
R8524:Spryd3 UTSW 15 102118148 nonsense probably null
R8713:Spryd3 UTSW 15 102133485 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCATGACAGAACCTGGCAGCTTC -3'
(R):5'- TCTTGATGTATTTGGACATCCGGCG -3'

Sequencing Primer
(F):5'- aaaaacaaaacaaaccagtgagag -3'
(R):5'- TTGGACATCCGGCGTCAAG -3'
Posted On2014-01-05