Incidental Mutation 'R1014:Myh11'
ID96054
Institutional Source Beutler Lab
Gene Symbol Myh11
Ensembl Gene ENSMUSG00000018830
Gene Namemyosin, heavy polypeptide 11, smooth muscle
SynonymssmMHC, SM1, SM2
MMRRC Submission 039118-MU
Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location14194535-14291372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14236410 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 363 (K363R)
Ref Sequence ENSEMBL: ENSMUSP00000155052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]
Predicted Effect probably benign
Transcript: ENSMUST00000090287
AA Change: K363R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: K363R

DomainStartEndE-ValueType
Pfam:Myosin_N 33 73 1e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 1.09e-2 SMART
Pfam:Myosin_tail_1 848 1928 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000230397
AA Change: K363R

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000231567
AA Change: K370R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Myh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Myh11 APN 16 14277722 missense probably benign 0.00
IGL01398:Myh11 APN 16 14202100 missense probably damaging 0.99
IGL01646:Myh11 APN 16 14221775 missense probably damaging 1.00
IGL02470:Myh11 APN 16 14218046 missense probably damaging 1.00
IGL02680:Myh11 APN 16 14209520 missense probably benign 0.02
IGL02687:Myh11 APN 16 14212618 nonsense probably null
IGL02987:Myh11 APN 16 14232532 missense probably damaging 1.00
IGL03008:Myh11 APN 16 14204753 missense probably benign 0.00
G5030:Myh11 UTSW 16 14250579 missense probably damaging 1.00
PIT4618001:Myh11 UTSW 16 14201066 missense
R0008:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0085:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0086:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0087:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0207:Myh11 UTSW 16 14211260 missense possibly damaging 0.95
R0326:Myh11 UTSW 16 14218880 missense probably benign 0.32
R0546:Myh11 UTSW 16 14205628 missense probably damaging 1.00
R0658:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0715:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R0839:Myh11 UTSW 16 14203178 missense probably damaging 1.00
R1104:Myh11 UTSW 16 14202127 missense possibly damaging 0.53
R1426:Myh11 UTSW 16 14205931 nonsense probably null
R1560:Myh11 UTSW 16 14226620 nonsense probably null
R1714:Myh11 UTSW 16 14236368 critical splice donor site probably null
R1742:Myh11 UTSW 16 14220044 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14200758 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14215790 missense probably damaging 0.98
R1753:Myh11 UTSW 16 14277870 missense probably benign
R1760:Myh11 UTSW 16 14233695 splice site probably benign
R1829:Myh11 UTSW 16 14223880 missense probably damaging 1.00
R1876:Myh11 UTSW 16 14269103 splice site probably benign
R2027:Myh11 UTSW 16 14232668 missense probably damaging 1.00
R2122:Myh11 UTSW 16 14218004 missense probably damaging 1.00
R2247:Myh11 UTSW 16 14277559 missense probably damaging 1.00
R2495:Myh11 UTSW 16 14205557 missense probably damaging 1.00
R2863:Myh11 UTSW 16 14239426 missense probably benign 0.02
R3684:Myh11 UTSW 16 14203234 missense probably benign 0.00
R3693:Myh11 UTSW 16 14217949 missense probably benign 0.01
R4080:Myh11 UTSW 16 14224059 missense possibly damaging 0.83
R4367:Myh11 UTSW 16 14218883 missense probably damaging 0.97
R4664:Myh11 UTSW 16 14226584 missense possibly damaging 0.70
R4673:Myh11 UTSW 16 14269241 missense probably damaging 0.99
R4694:Myh11 UTSW 16 14200702 missense probably damaging 1.00
R4805:Myh11 UTSW 16 14234465 missense possibly damaging 0.61
R4806:Myh11 UTSW 16 14201083 splice site probably null
R4905:Myh11 UTSW 16 14250523 missense probably benign 0.13
R4939:Myh11 UTSW 16 14239507 missense probably benign
R4964:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R4966:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R5029:Myh11 UTSW 16 14205625 missense probably damaging 1.00
R5045:Myh11 UTSW 16 14239527 nonsense probably null
R5097:Myh11 UTSW 16 14205906 splice site probably null
R5288:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5385:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5621:Myh11 UTSW 16 14244855 missense probably damaging 0.96
R5856:Myh11 UTSW 16 14205976 missense probably benign 0.00
R5869:Myh11 UTSW 16 14230800 missense probably damaging 1.00
R6019:Myh11 UTSW 16 14206074 missense probably damaging 1.00
R6024:Myh11 UTSW 16 14277703 missense probably damaging 0.99
R6139:Myh11 UTSW 16 14215874 missense probably damaging 1.00
R6209:Myh11 UTSW 16 14208291 nonsense probably null
R6373:Myh11 UTSW 16 14205130 missense possibly damaging 0.72
R6671:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R6688:Myh11 UTSW 16 14205553 missense probably damaging 1.00
R6709:Myh11 UTSW 16 14223494 critical splice donor site probably null
R7069:Myh11 UTSW 16 14218939 missense possibly damaging 0.95
R7176:Myh11 UTSW 16 14215826 missense
R7644:Myh11 UTSW 16 14221824 missense
R7838:Myh11 UTSW 16 14209617 missense
R7905:Myh11 UTSW 16 14207681 nonsense probably null
R8261:Myh11 UTSW 16 14224003 missense
R8272:Myh11 UTSW 16 14218854 missense
R8317:Myh11 UTSW 16 14208077 missense
R8359:Myh11 UTSW 16 14208231 critical splice donor site probably null
R8486:Myh11 UTSW 16 14204668 missense possibly damaging 0.77
R8527:Myh11 UTSW 16 14230706 missense probably damaging 1.00
R8861:Myh11 UTSW 16 14246782 missense
R8886:Myh11 UTSW 16 14234414 missense
X0018:Myh11 UTSW 16 14277633 missense probably damaging 1.00
X0025:Myh11 UTSW 16 14209689 missense possibly damaging 0.93
X0027:Myh11 UTSW 16 14234402 missense probably damaging 1.00
Z1088:Myh11 UTSW 16 14269262 frame shift probably null
Z1176:Myh11 UTSW 16 14239396 missense probably null
Z1176:Myh11 UTSW 16 14277775 missense
Z1177:Myh11 UTSW 16 14209595 missense
Predicted Primers PCR Primer
(F):5'- GCTGACTGCCATGTGTAGCCATAG -3'
(R):5'- TTCCAGCAACTTCCTGGCAATACTC -3'

Sequencing Primer
(F):5'- actgcCATGTGTAGCCATAGATAAG -3'
(R):5'- CAGGGAGTCAGACAATCTTGTCC -3'
Posted On2014-01-05