Incidental Mutation 'R1014:Cul7'
ID96058
Institutional Source Beutler Lab
Gene Symbol Cul7
Ensembl Gene ENSMUSG00000038545
Gene Namecullin 7
Synonymsp185, 2510004L20Rik, C230011P08Rik, p193
MMRRC Submission 039118-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46650337-46664364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46663190 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 1467 (L1467H)
Ref Sequence ENSEMBL: ENSMUSP00000049128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024766] [ENSMUST00000043464] [ENSMUST00000133393] [ENSMUST00000145567]
Predicted Effect probably benign
Transcript: ENSMUST00000024766
SMART Domains Protein: ENSMUSP00000024766
Gene: ENSMUSG00000023971

DomainStartEndE-ValueType
Pfam:DUF947 55 219 7.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043464
AA Change: L1467H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545
AA Change: L1467H

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125949
Predicted Effect probably benign
Transcript: ENSMUST00000133393
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145567
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.4846 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: During late gestation, homozygous null fetuses display reduced growth associated with abnormal placental development and hemorrhaging due to vascular defects. Mutant mice are born but die shortly after birth, succumbing to respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb11 T A 18: 37,423,369 L584Q probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Cul7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Cul7 APN 17 46652508 missense probably damaging 1.00
IGL01288:Cul7 APN 17 46657807 splice site probably benign
IGL01669:Cul7 APN 17 46658715 missense possibly damaging 0.94
P0019:Cul7 UTSW 17 46660247 splice site probably benign
PIT4453001:Cul7 UTSW 17 46651820 missense probably damaging 0.99
R0083:Cul7 UTSW 17 46655556 missense probably benign 0.00
R0121:Cul7 UTSW 17 46663373 missense probably damaging 1.00
R0157:Cul7 UTSW 17 46653835 missense possibly damaging 0.93
R0266:Cul7 UTSW 17 46654595 missense probably benign 0.00
R0358:Cul7 UTSW 17 46663744 critical splice donor site probably null
R0544:Cul7 UTSW 17 46663544 missense possibly damaging 0.94
R0565:Cul7 UTSW 17 46652003 missense probably damaging 0.98
R0677:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0696:Cul7 UTSW 17 46659608 missense probably damaging 1.00
R0702:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0735:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0893:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0900:Cul7 UTSW 17 46658337 missense probably benign 0.36
R0975:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0976:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1016:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1104:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1162:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1378:Cul7 UTSW 17 46662126 missense probably damaging 0.99
R1479:Cul7 UTSW 17 46651747 missense probably damaging 1.00
R1498:Cul7 UTSW 17 46655710 missense probably benign 0.01
R1521:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1542:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1545:Cul7 UTSW 17 46651553 missense probably damaging 1.00
R1598:Cul7 UTSW 17 46663091 missense probably benign 0.10
R1600:Cul7 UTSW 17 46651822 nonsense probably null
R1618:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1752:Cul7 UTSW 17 46653167 missense probably benign 0.10
R1881:Cul7 UTSW 17 46651962 missense probably damaging 1.00
R1901:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1902:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1913:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R2213:Cul7 UTSW 17 46651472 missense probably damaging 0.99
R2370:Cul7 UTSW 17 46661641 missense probably damaging 1.00
R2929:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2930:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2990:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2992:Cul7 UTSW 17 46651600 missense probably benign 0.00
R4201:Cul7 UTSW 17 46661312 missense probably damaging 1.00
R4792:Cul7 UTSW 17 46657050 nonsense probably null
R4971:Cul7 UTSW 17 46659119 missense probably benign 0.00
R5014:Cul7 UTSW 17 46655942 makesense probably null
R5384:Cul7 UTSW 17 46654477 missense probably benign 0.44
R5957:Cul7 UTSW 17 46657757 missense probably damaging 1.00
R6128:Cul7 UTSW 17 46651662 missense probably damaging 1.00
R6294:Cul7 UTSW 17 46663148 missense probably benign
R6812:Cul7 UTSW 17 46661409 missense probably benign 0.00
R7073:Cul7 UTSW 17 46658731 missense probably damaging 1.00
R7112:Cul7 UTSW 17 46651698 missense probably damaging 1.00
R7246:Cul7 UTSW 17 46662067 missense probably benign 0.04
R7361:Cul7 UTSW 17 46657007 missense probably damaging 1.00
R7567:Cul7 UTSW 17 46654595 missense probably benign 0.00
R7682:Cul7 UTSW 17 46655595 missense probably benign
R7689:Cul7 UTSW 17 46652821 nonsense probably null
R7797:Cul7 UTSW 17 46658642 missense possibly damaging 0.65
R7897:Cul7 UTSW 17 46658005 missense probably benign
R8783:Cul7 UTSW 17 46655649 missense probably benign
Z1177:Cul7 UTSW 17 46652805 frame shift probably null
Z1177:Cul7 UTSW 17 46658738 missense probably damaging 0.99
Z1177:Cul7 UTSW 17 46659569 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCAGAAGCCATCGTGCCCAGAAG -3'
(R):5'- ATTCCTGACTCAGAGCAGTCTGCC -3'

Sequencing Primer
(F):5'- ATCGTGCCCAGAAGTCCTG -3'
(R):5'- CAAAGAGTTTAGATCCTCGGGG -3'
Posted On2014-01-05