Mutagenetix > Incidental Mutation

Incidental Mutation 'R1014:Pcdhb5'

96060

Institutional Source

Beutler Lab

Gene Symbol

Pcdhb5

Ensembl Gene

ENSMUSG00000063687

Gene Name

protocadherin beta 5

Synonyms

Pcdhb4A, PcdhbE

MMRRC Submission

039118-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R1014 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37320381-37323915 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37322250 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 561 (L561P)

Ref Sequence

ENSEMBL: ENSMUSP00000077389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]

AlphaFold

Q91XZ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000078271
AA Change: L561P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: L561P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	46	130	1.55e0	SMART
CA	154	239	2.42e-18	SMART
CA	263	344	1.27e-26	SMART
CA	367	448	1.14e-23	SMART
CA	472	558	2.38e-26	SMART
CA	588	669	7.06e-11	SMART
Pfam:Cadherin_C_2	686	769	3.1e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115661

SMART Domains

Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

Domain	Start	End	E-Value	Type
CA	20	131	5.3e-2	SMART
CA	155	240	1.51e-19	SMART
CA	264	348	7.6e-25	SMART
CA	372	453	1.42e-24	SMART
CA	477	563	1.42e-24	SMART
CA	594	674	4.12e-12	SMART
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cadherin_tail	796	930	3.9e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193984

Predicted Effect

probably benign
Transcript: ENSMUST00000194544

SMART Domains

Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

Domain	Start	End	E-Value	Type
Blast:CA	18	66	5e-20	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ago4	T	C	4: 126,506,785	R712G	probably damaging	Het
Arg1	C	A	10: 24,916,860	V159L	probably benign	Het
Caap1	C	T	4: 94,549,146	C193Y	probably benign	Het
Cdh12	A	T	15: 21,492,620	M242L	probably damaging	Het
Col19a1	A	T	1: 24,301,273		probably null	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
D430041D05Rik	T	C	2: 104,258,329	T101A	possibly damaging	Het
Dll4	T	C	2: 119,331,157	C407R	probably damaging	Het
Ebf4	T	C	2: 130,365,468	S484P	probably benign	Het
Gm10300	A	G	4: 132,074,712		probably benign	Het
Lyst	T	C	13: 13,634,060	I105T	possibly damaging	Het
Mrgprx2	A	G	7: 48,482,558		probably null	Het
Musk	T	C	4: 58,354,156	L403P	possibly damaging	Het
Myh11	T	C	16: 14,236,410	K363R	possibly damaging	Het
Nadk2	T	C	15: 9,091,254	F202L	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nup210l	C	T	3: 90,170,048	T897M	possibly damaging	Het
Olfr651	T	C	7: 104,553,176	W86R	probably damaging	Het
Pcdh17	A	G	14: 84,447,488	D465G	probably damaging	Het
Pcdhb11	T	A	18: 37,423,369	L584Q	probably damaging	Het
Pck2	A	G	14: 55,542,410	S12G	probably benign	Het
Pcsk1	A	G	13: 75,132,234	D726G	probably damaging	Het
Pcsk5	G	T	19: 17,564,830	A799E	probably damaging	Het
Pkp3	A	G	7: 141,082,826	Y117C	probably benign	Het
Poldip2	T	A	11: 78,515,162	D106E	probably damaging	Het
Ppm1d	C	A	11: 85,337,154	H299N	probably damaging	Het
Ptprz1	A	G	6: 23,000,644	Y911C	probably damaging	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Rtf1	T	G	2: 119,720,246	S329A	possibly damaging	Het
Slc12a2	T	C	18: 57,921,810	I841T	probably benign	Het
Slc2a3	T	C	6: 122,731,566	I367V	possibly damaging	Het
Slc30a8	A	G	15: 52,331,597	T251A	probably damaging	Het
Spryd3	T	A	15: 102,133,531	N19Y	probably damaging	Het
Tll2	A	T	19: 41,103,851	Y516N	probably damaging	Het
Tlr5	G	A	1: 182,975,677	G849R	probably benign	Het
Wdr64	A	G	1: 175,755,626	E376G	probably damaging	Het
Zfp318	GAA	GAANAA	17: 46,412,536		probably null	Het

Other mutations in Pcdhb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Pcdhb5	APN	18	37322109	missense	probably damaging	1.00
IGL00895:Pcdhb5	APN	18	37320983	missense	probably benign	0.42
IGL00896:Pcdhb5	APN	18	37322785	splice site	probably null
IGL01385:Pcdhb5	APN	18	37322214	missense	probably benign	0.00
IGL01619:Pcdhb5	APN	18	37322939	missense	probably damaging	1.00
IGL01712:Pcdhb5	APN	18	37321253	missense	probably damaging	1.00
IGL01716:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01719:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01720:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01723:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01724:Pcdhb5	APN	18	37321022	missense	probably benign
IGL01839:Pcdhb5	APN	18	37321449	missense	probably damaging	0.98
IGL01884:Pcdhb5	APN	18	37321334	missense	probably benign	0.00
IGL01962:Pcdhb5	APN	18	37321040	missense	probably damaging	1.00
IGL02088:Pcdhb5	APN	18	37321959	missense	probably benign	0.11
IGL02299:Pcdhb5	APN	18	37320890	missense	probably benign
IGL02444:Pcdhb5	APN	18	37321050	missense	probably benign	0.01
IGL03372:Pcdhb5	APN	18	37320660	missense	probably benign	0.22
R0034:Pcdhb5	UTSW	18	37322084	missense	probably damaging	1.00
R0047:Pcdhb5	UTSW	18	37321268	missense	possibly damaging	0.87
R0179:Pcdhb5	UTSW	18	37322559	missense	probably damaging	1.00
R0466:Pcdhb5	UTSW	18	37322543	missense	probably damaging	1.00
R0471:Pcdhb5	UTSW	18	37321306	nonsense	probably null
R0565:Pcdhb5	UTSW	18	37320767	missense	possibly damaging	0.91
R0646:Pcdhb5	UTSW	18	37321622	missense	probably benign
R1617:Pcdhb5	UTSW	18	37321402	nonsense	probably null
R1676:Pcdhb5	UTSW	18	37320752	missense	probably benign	0.01
R1774:Pcdhb5	UTSW	18	37322672	missense	probably damaging	0.99
R1826:Pcdhb5	UTSW	18	37321469	nonsense	probably null
R1854:Pcdhb5	UTSW	18	37322340	missense	possibly damaging	0.94
R2355:Pcdhb5	UTSW	18	37322116	missense	probably benign
R4290:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4292:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4293:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4294:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4295:Pcdhb5	UTSW	18	37322681	missense	possibly damaging	0.90
R4391:Pcdhb5	UTSW	18	37322736	missense	possibly damaging	0.88
R4411:Pcdhb5	UTSW	18	37321997	missense	possibly damaging	0.80
R4480:Pcdhb5	UTSW	18	37320752	missense	probably benign	0.43
R4852:Pcdhb5	UTSW	18	37322471	missense	probably benign	0.04
R5121:Pcdhb5	UTSW	18	37321117	missense	probably benign	0.11
R5133:Pcdhb5	UTSW	18	37320890	missense	probably benign
R5630:Pcdhb5	UTSW	18	37321155	missense	possibly damaging	0.88
R5833:Pcdhb5	UTSW	18	37321102	missense	probably damaging	0.99
R5896:Pcdhb5	UTSW	18	37322679	nonsense	probably null
R5942:Pcdhb5	UTSW	18	37320785	nonsense	probably null
R5945:Pcdhb5	UTSW	18	37321470	missense	probably benign	0.08
R5970:Pcdhb5	UTSW	18	37321773	missense	probably damaging	1.00
R6045:Pcdhb5	UTSW	18	37321575	missense	probably damaging	1.00
R6054:Pcdhb5	UTSW	18	37321080	missense	probably damaging	0.98
R6147:Pcdhb5	UTSW	18	37320726	missense	probably damaging	1.00
R6152:Pcdhb5	UTSW	18	37322833	nonsense	probably null
R6193:Pcdhb5	UTSW	18	37322027	missense	probably damaging	1.00
R6397:Pcdhb5	UTSW	18	37321505	missense	probably benign	0.08
R6505:Pcdhb5	UTSW	18	37320880	missense	probably benign	0.00
R6608:Pcdhb5	UTSW	18	37321823	missense	probably damaging	0.98
R6737:Pcdhb5	UTSW	18	37322670	missense	probably damaging	1.00
R7146:Pcdhb5	UTSW	18	37321356	missense	probably damaging	1.00
R7162:Pcdhb5	UTSW	18	37321686	missense	probably benign	0.16
R7584:Pcdhb5	UTSW	18	37322372	missense	possibly damaging	0.90
R8214:Pcdhb5	UTSW	18	37321583	missense	probably benign	0.37
R8327:Pcdhb5	UTSW	18	37320900	missense	probably benign	0.00
R8676:Pcdhb5	UTSW	18	37321076	missense	probably benign	0.01
R9234:Pcdhb5	UTSW	18	37320642	missense	probably benign
R9424:Pcdhb5	UTSW	18	37321067	missense	probably damaging	1.00
R9505:Pcdhb5	UTSW	18	37321611	missense	possibly damaging	0.87
R9635:Pcdhb5	UTSW	18	37321457	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TTTGTCCGCGAGAACAACAGCC -3'
(R):5'- ATTGTGAGCCCACACGCTGAAC -3'

Sequencing Primer
(F):5'- GACTCAGGCTCCAATGCTC -3'
(R):5'- ACACGCTGAACAGTCCG -3'

Posted On

2014-01-05