Incidental Mutation 'R1014:Pcdhb11'
ID96062
Institutional Source Beutler Lab
Gene Symbol Pcdhb11
Ensembl Gene ENSMUSG00000051486
Gene Nameprotocadherin beta 11
SynonymsPcdhb5E, PcdhbK
MMRRC Submission 039118-MU
Accession Numbers

Genbank: NM_053136.3; Ensembl: ENSMUST00000053073

Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1014 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37421418-37425836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37423369 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 584 (L584Q)
Ref Sequence ENSEMBL: ENSMUSP00000056148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053073] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000053073
AA Change: L584Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056148
Gene: ENSMUSG00000051486
AA Change: L584Q

DomainStartEndE-ValueType
CA 54 131 3.51e-1 SMART
CA 155 240 4.11e-21 SMART
CA 264 344 6.37e-27 SMART
CA 367 448 4.79e-22 SMART
CA 472 558 7.31e-27 SMART
CA 588 669 2.46e-10 SMART
Pfam:Cadherin_C_2 686 769 3.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 T C 4: 126,506,785 R712G probably damaging Het
Arg1 C A 10: 24,916,860 V159L probably benign Het
Caap1 C T 4: 94,549,146 C193Y probably benign Het
Cdh12 A T 15: 21,492,620 M242L probably damaging Het
Col19a1 A T 1: 24,301,273 probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
D430041D05Rik T C 2: 104,258,329 T101A possibly damaging Het
Dll4 T C 2: 119,331,157 C407R probably damaging Het
Ebf4 T C 2: 130,365,468 S484P probably benign Het
Gm10300 A G 4: 132,074,712 probably benign Het
Lyst T C 13: 13,634,060 I105T possibly damaging Het
Mrgprx2 A G 7: 48,482,558 probably null Het
Musk T C 4: 58,354,156 L403P possibly damaging Het
Myh11 T C 16: 14,236,410 K363R possibly damaging Het
Nadk2 T C 15: 9,091,254 F202L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nup210l C T 3: 90,170,048 T897M possibly damaging Het
Olfr651 T C 7: 104,553,176 W86R probably damaging Het
Pcdh17 A G 14: 84,447,488 D465G probably damaging Het
Pcdhb5 T C 18: 37,322,250 L561P probably damaging Het
Pck2 A G 14: 55,542,410 S12G probably benign Het
Pcsk1 A G 13: 75,132,234 D726G probably damaging Het
Pcsk5 G T 19: 17,564,830 A799E probably damaging Het
Pkp3 A G 7: 141,082,826 Y117C probably benign Het
Poldip2 T A 11: 78,515,162 D106E probably damaging Het
Ppm1d C A 11: 85,337,154 H299N probably damaging Het
Ptprz1 A G 6: 23,000,644 Y911C probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rtf1 T G 2: 119,720,246 S329A possibly damaging Het
Slc12a2 T C 18: 57,921,810 I841T probably benign Het
Slc2a3 T C 6: 122,731,566 I367V possibly damaging Het
Slc30a8 A G 15: 52,331,597 T251A probably damaging Het
Spryd3 T A 15: 102,133,531 N19Y probably damaging Het
Tll2 A T 19: 41,103,851 Y516N probably damaging Het
Tlr5 G A 1: 182,975,677 G849R probably benign Het
Wdr64 A G 1: 175,755,626 E376G probably damaging Het
Zfp318 GAA GAANAA 17: 46,412,536 probably null Het
Other mutations in Pcdhb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Pcdhb11 APN 18 37421973 missense probably benign 0.00
IGL00906:Pcdhb11 APN 18 37422121 missense possibly damaging 0.67
IGL01610:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL01973:Pcdhb11 APN 18 37423512 missense probably damaging 1.00
IGL01977:Pcdhb11 APN 18 37422291 missense possibly damaging 0.49
IGL02164:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL02282:Pcdhb11 APN 18 37423828 missense probably damaging 1.00
IGL02674:Pcdhb11 APN 18 37423614 missense probably damaging 1.00
IGL02965:Pcdhb11 APN 18 37423968 missense probably benign
IGL03197:Pcdhb11 APN 18 37422424 nonsense probably null
1mM(1):Pcdhb11 UTSW 18 37423957 missense probably benign 0.00
R0001:Pcdhb11 UTSW 18 37423989 missense probably benign 0.06
R0383:Pcdhb11 UTSW 18 37423393 missense probably damaging 1.00
R0421:Pcdhb11 UTSW 18 37422480 missense probably benign 0.04
R0422:Pcdhb11 UTSW 18 37421870 missense probably damaging 1.00
R0427:Pcdhb11 UTSW 18 37422765 missense probably damaging 1.00
R0542:Pcdhb11 UTSW 18 37423834 missense probably damaging 1.00
R0620:Pcdhb11 UTSW 18 37421811 nonsense probably null
R1277:Pcdhb11 UTSW 18 37421716 missense possibly damaging 0.79
R2034:Pcdhb11 UTSW 18 37422493 missense probably benign 0.00
R2142:Pcdhb11 UTSW 18 37422123 missense probably benign 0.28
R2496:Pcdhb11 UTSW 18 37422322 missense probably benign 0.30
R3077:Pcdhb11 UTSW 18 37422244 missense probably benign 0.08
R4560:Pcdhb11 UTSW 18 37423734 missense possibly damaging 0.61
R4590:Pcdhb11 UTSW 18 37422496 missense probably damaging 0.98
R4642:Pcdhb11 UTSW 18 37421968 missense probably benign 0.01
R4729:Pcdhb11 UTSW 18 37422366 nonsense probably null
R5012:Pcdhb11 UTSW 18 37422976 missense possibly damaging 0.48
R5364:Pcdhb11 UTSW 18 37422179 missense probably benign 0.06
R5910:Pcdhb11 UTSW 18 37423743 missense probably benign 0.43
R6023:Pcdhb11 UTSW 18 37422925 missense possibly damaging 0.94
R6106:Pcdhb11 UTSW 18 37423003 missense probably damaging 1.00
R6254:Pcdhb11 UTSW 18 37421718 missense probably damaging 0.99
R6276:Pcdhb11 UTSW 18 37421760 missense probably benign 0.36
R6360:Pcdhb11 UTSW 18 37422159 missense probably benign
R6699:Pcdhb11 UTSW 18 37422937 missense probably damaging 1.00
R6732:Pcdhb11 UTSW 18 37422144 missense probably benign
R6760:Pcdhb11 UTSW 18 37421584 intron probably benign
R6916:Pcdhb11 UTSW 18 37422381 missense possibly damaging 0.52
R7130:Pcdhb11 UTSW 18 37423506 missense probably benign 0.04
R7267:Pcdhb11 UTSW 18 37421953 missense possibly damaging 0.61
R7426:Pcdhb11 UTSW 18 37423260 missense probably damaging 0.99
R7444:Pcdhb11 UTSW 18 37422619 missense probably damaging 0.98
R7492:Pcdhb11 UTSW 18 37423444 missense probably damaging 1.00
R7504:Pcdhb11 UTSW 18 37421799 missense probably benign
R7537:Pcdhb11 UTSW 18 37421619 start codon destroyed possibly damaging 0.88
R7728:Pcdhb11 UTSW 18 37423477 missense probably damaging 1.00
R7817:Pcdhb11 UTSW 18 37423909 missense probably damaging 1.00
R8071:Pcdhb11 UTSW 18 37422369 missense probably benign 0.02
R8229:Pcdhb11 UTSW 18 37422618 missense probably benign 0.00
R8254:Pcdhb11 UTSW 18 37422189 missense probably benign 0.45
R8356:Pcdhb11 UTSW 18 37422199 missense probably damaging 1.00
R8739:Pcdhb11 UTSW 18 37422496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACTCAGACTCAGGCTCCAATG -3'
(R):5'- ATTGTCCTTGACCAGCAGCAGC -3'

Sequencing Primer
(F):5'- CTCAGGGCACTGGACTATGAATC -3'
(R):5'- AGCAGCAGCAGCCTGTG -3'
Posted On2014-01-05