Incidental Mutation 'R1125:Glra3'
ID96063
Institutional Source Beutler Lab
Gene Symbol Glra3
Ensembl Gene ENSMUSG00000038257
Gene Nameglycine receptor, alpha 3 subunit
Synonyms
MMRRC Submission 039198-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1125 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location55940460-56130070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56039754 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 163 (D163G)
Ref Sequence ENSEMBL: ENSMUSP00000000275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000275
AA Change: D163G

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000275
Gene: ENSMUSG00000038257
AA Change: D163G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 269 3.7e-55 PFAM
Pfam:Neur_chan_memb 276 434 1.4e-35 PFAM
PDB:2M6I|E 437 474 1e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164020
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ligand-gated ion channel protein family. The encoded protein is a member of the glycine receptor subfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are fertile and display decreased inflammatory pain sensitization without any gross abnormalities in the brain or spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,978 I254T probably benign Het
Abcb5 T C 12: 118,911,547 D630G possibly damaging Het
Anks4b T G 7: 120,182,357 F204V possibly damaging Het
C87436 T C 6: 86,447,362 V282A probably benign Het
Cav3 T A 6: 112,472,296 F92I probably damaging Het
Cbs A T 17: 31,632,831 V66E probably benign Het
Cd226 A G 18: 89,267,922 I172V probably benign Het
Ctns C A 11: 73,187,837 probably null Het
Fam166b A G 4: 43,427,550 I258T probably damaging Het
Gid4 A G 11: 60,424,781 D66G possibly damaging Het
Lrrc23 A G 6: 124,776,182 V167A probably benign Het
Nbea A T 3: 55,857,006 L1979* probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Necab1 T A 4: 15,111,257 D57V probably damaging Het
Olfr693 T A 7: 106,678,007 T160S possibly damaging Het
Plekhd1 C A 12: 80,707,224 Q155K possibly damaging Het
Ppara A G 15: 85,789,055 N149S possibly damaging Het
Slc30a5 C T 13: 100,803,413 V665M probably damaging Het
Sntb1 T G 15: 55,749,280 T301P probably benign Het
Tlr5 A T 1: 182,973,892 T240S probably benign Het
Ttc5 A G 14: 50,777,878 L92P probably damaging Het
Ttll10 A G 4: 156,035,038 S664P possibly damaging Het
Uhrf1bp1 T C 17: 27,893,449 V1204A probably damaging Het
Vmn2r45 G A 7: 8,485,543 R163C probably benign Het
Vmn2r94 T C 17: 18,257,455 I231M probably damaging Het
Other mutations in Glra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Glra3 APN 8 55940977 splice site probably benign
IGL01301:Glra3 APN 8 55940962 missense probably benign 0.00
IGL01772:Glra3 APN 8 56089055 missense probably benign 0.22
IGL02280:Glra3 APN 8 55940971 missense possibly damaging 0.67
IGL02386:Glra3 APN 8 56089028 missense probably benign 0.12
IGL02508:Glra3 APN 8 56085144 missense probably benign 0.10
IGL03094:Glra3 APN 8 56125172 missense probably benign
ANU18:Glra3 UTSW 8 55940962 missense probably benign 0.00
R0532:Glra3 UTSW 8 56125076 missense probably benign
R0708:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R0710:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R0927:Glra3 UTSW 8 56125204 missense possibly damaging 0.65
R1138:Glra3 UTSW 8 56088976 splice site probably null
R1717:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1718:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1848:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1933:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1934:Glra3 UTSW 8 55940907 missense probably benign 0.07
R2042:Glra3 UTSW 8 56062459 missense probably benign 0.36
R2571:Glra3 UTSW 8 56110481 missense probably benign 0.41
R3123:Glra3 UTSW 8 56125209 missense possibly damaging 0.94
R3124:Glra3 UTSW 8 56125209 missense possibly damaging 0.94
R4585:Glra3 UTSW 8 56088993 missense probably damaging 1.00
R4593:Glra3 UTSW 8 55940881 missense probably damaging 1.00
R4981:Glra3 UTSW 8 55991235 missense possibly damaging 0.69
R5277:Glra3 UTSW 8 55991207 missense possibly damaging 0.79
R5356:Glra3 UTSW 8 55940901 missense probably benign 0.00
R6214:Glra3 UTSW 8 55991256 splice site probably null
R6941:Glra3 UTSW 8 55940926 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTCAGAAGTGGAATGATCCTCGTC -3'
(R):5'- TCTAGAGCCTTGATATGTGGCCCAG -3'

Sequencing Primer
(F):5'- GAATGATCCTCGTCTTGCATACAG -3'
(R):5'- CAATTGCTATTGTGAATGCTGCC -3'
Posted On2014-01-05