Mutagenetix > Incidental Mutation

Incidental Mutation 'R1125:Uhrf1bp1'

96096

Institutional Source

Beutler Lab

Gene Symbol

Uhrf1bp1

Ensembl Gene

ENSMUSG00000039512

Gene Name

UHRF1 (ICBP90) binding protein 1

Synonyms

1110020K19Rik, F830021D11Rik

MMRRC Submission

039198-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1125 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27856490-27900040 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27893449 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1204 (V1204A)

Ref Sequence

ENSEMBL: ENSMUSP00000110499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114849]

AlphaFold

B2KF50

Predicted Effect

probably damaging
Transcript: ENSMUST00000114849
AA Change: V1204A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: V1204A

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	1	104	2.6e-18	PFAM
low complexity region	234	247	N/A	INTRINSIC
low complexity region	297	306	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
low complexity region	1200	1216	N/A	INTRINSIC
low complexity region	1322	1333	N/A	INTRINSIC
low complexity region	1375	1386	N/A	INTRINSIC
coiled coil region	1394	1424	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137825

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	T	C	19: 31,920,978	I254T	probably benign	Het
Abcb5	T	C	12: 118,911,547	D630G	possibly damaging	Het
Anks4b	T	G	7: 120,182,357	F204V	possibly damaging	Het
C87436	T	C	6: 86,447,362	V282A	probably benign	Het
Cav3	T	A	6: 112,472,296	F92I	probably damaging	Het
Cbs	A	T	17: 31,632,831	V66E	probably benign	Het
Cd226	A	G	18: 89,267,922	I172V	probably benign	Het
Ctns	C	A	11: 73,187,837		probably null	Het
Fam166b	A	G	4: 43,427,550	I258T	probably damaging	Het
Gid4	A	G	11: 60,424,781	D66G	possibly damaging	Het
Glra3	A	G	8: 56,039,754	D163G	possibly damaging	Het
Lrrc23	A	G	6: 124,776,182	V167A	probably benign	Het
Nbea	A	T	3: 55,857,006	L1979*	probably null	Het
Nckap1	C	T	2: 80,517,942	S889N	probably benign	Het
Necab1	T	A	4: 15,111,257	D57V	probably damaging	Het
Olfr693	T	A	7: 106,678,007	T160S	possibly damaging	Het
Plekhd1	C	A	12: 80,707,224	Q155K	possibly damaging	Het
Ppara	A	G	15: 85,789,055	N149S	possibly damaging	Het
Slc30a5	C	T	13: 100,803,413	V665M	probably damaging	Het
Sntb1	T	G	15: 55,749,280	T301P	probably benign	Het
Tlr5	A	T	1: 182,973,892	T240S	probably benign	Het
Ttc5	A	G	14: 50,777,878	L92P	probably damaging	Het
Ttll10	A	G	4: 156,035,038	S664P	possibly damaging	Het
Vmn2r45	G	A	7: 8,485,543	R163C	probably benign	Het
Vmn2r94	T	C	17: 18,257,455	I231M	probably damaging	Het

Other mutations in Uhrf1bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Uhrf1bp1	APN	17	27876917	splice site	probably benign
IGL00786:Uhrf1bp1	APN	17	27879292	missense	probably damaging	0.99
IGL01074:Uhrf1bp1	APN	17	27879291	missense	possibly damaging	0.94
IGL01780:Uhrf1bp1	APN	17	27893500	missense	probably damaging	1.00
IGL02668:Uhrf1bp1	APN	17	27886575	missense	possibly damaging	0.53
IGL02686:Uhrf1bp1	APN	17	27894589	missense	probably benign
IGL03240:Uhrf1bp1	APN	17	27893253	missense	probably benign	0.37
hades	UTSW	17	27894746	missense	probably damaging	1.00
R0167:Uhrf1bp1	UTSW	17	27880202	missense	possibly damaging	0.46
R0240:Uhrf1bp1	UTSW	17	27895870	splice site	probably benign
R0332:Uhrf1bp1	UTSW	17	27893294	critical splice donor site	probably null
R0668:Uhrf1bp1	UTSW	17	27895939	missense	probably benign	0.16
R0726:Uhrf1bp1	UTSW	17	27885489	missense	possibly damaging	0.50
R0964:Uhrf1bp1	UTSW	17	27887178	missense	probably damaging	0.96
R1139:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1164:Uhrf1bp1	UTSW	17	27895380	critical splice donor site	probably null
R1192:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1277:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1279:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1340:Uhrf1bp1	UTSW	17	27894721	missense	probably benign	0.00
R1341:Uhrf1bp1	UTSW	17	27877419	splice site	probably benign
R1344:Uhrf1bp1	UTSW	17	27894577	missense	probably benign	0.41
R1418:Uhrf1bp1	UTSW	17	27894577	missense	probably benign	0.41
R1552:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R1726:Uhrf1bp1	UTSW	17	27886251	splice site	probably null
R1791:Uhrf1bp1	UTSW	17	27894746	missense	probably damaging	1.00
R1796:Uhrf1bp1	UTSW	17	27890071	missense	possibly damaging	0.87
R2858:Uhrf1bp1	UTSW	17	27885462	missense	probably damaging	0.99
R3034:Uhrf1bp1	UTSW	17	27894746	missense	probably damaging	1.00
R4111:Uhrf1bp1	UTSW	17	27886090	nonsense	probably null
R4159:Uhrf1bp1	UTSW	17	27884087	missense	probably damaging	1.00
R4160:Uhrf1bp1	UTSW	17	27884087	missense	probably damaging	1.00
R4161:Uhrf1bp1	UTSW	17	27884087	missense	probably damaging	1.00
R4431:Uhrf1bp1	UTSW	17	27885931	missense	probably damaging	1.00
R4575:Uhrf1bp1	UTSW	17	27887503	missense	probably benign	0.02
R4657:Uhrf1bp1	UTSW	17	27890105	missense	probably benign	0.09
R4666:Uhrf1bp1	UTSW	17	27893503	missense	possibly damaging	0.95
R4825:Uhrf1bp1	UTSW	17	27877394	missense	probably damaging	0.98
R4872:Uhrf1bp1	UTSW	17	27890136	missense	probably benign	0.10
R4956:Uhrf1bp1	UTSW	17	27889984	splice site	probably null
R4976:Uhrf1bp1	UTSW	17	27884026	missense	probably damaging	0.99
R4982:Uhrf1bp1	UTSW	17	27886606	missense	probably benign	0.05
R5017:Uhrf1bp1	UTSW	17	27894739	nonsense	probably null
R5033:Uhrf1bp1	UTSW	17	27886864	missense	probably damaging	0.99
R5137:Uhrf1bp1	UTSW	17	27876990	splice site	probably null
R5159:Uhrf1bp1	UTSW	17	27881556	missense	probably damaging	0.98
R5177:Uhrf1bp1	UTSW	17	27885018	missense	possibly damaging	0.94
R5196:Uhrf1bp1	UTSW	17	27856763	missense	probably benign	0.09
R5214:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5352:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5354:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5425:Uhrf1bp1	UTSW	17	27887515	missense	probably benign
R5601:Uhrf1bp1	UTSW	17	27884494	missense	probably damaging	1.00
R6080:Uhrf1bp1	UTSW	17	27880297	missense	probably benign
R6088:Uhrf1bp1	UTSW	17	27884605	critical splice donor site	probably null
R6331:Uhrf1bp1	UTSW	17	27893201	missense	probably benign	0.01
R6529:Uhrf1bp1	UTSW	17	27879776	missense	possibly damaging	0.90
R6614:Uhrf1bp1	UTSW	17	27876925	missense	probably benign	0.18
R6701:Uhrf1bp1	UTSW	17	27887357	nonsense	probably null
R7082:Uhrf1bp1	UTSW	17	27890065	missense	probably damaging	1.00
R7158:Uhrf1bp1	UTSW	17	27886433	nonsense	probably null
R8338:Uhrf1bp1	UTSW	17	27876695	missense	probably damaging	1.00
R8914:Uhrf1bp1	UTSW	17	27886913	missense	possibly damaging	0.66
R9135:Uhrf1bp1	UTSW	17	27885928	nonsense	probably null
R9218:Uhrf1bp1	UTSW	17	27895555	missense	probably benign	0.00
R9421:Uhrf1bp1	UTSW	17	27876686	missense	probably damaging	1.00
R9495:Uhrf1bp1	UTSW	17	27893440	missense	probably damaging	1.00
R9514:Uhrf1bp1	UTSW	17	27893440	missense	probably damaging	1.00
R9621:Uhrf1bp1	UTSW	17	27886779	missense	probably benign	0.00
R9766:Uhrf1bp1	UTSW	17	27886825	missense	probably damaging	1.00
RF005:Uhrf1bp1	UTSW	17	27885531	missense	probably damaging	1.00
X0017:Uhrf1bp1	UTSW	17	27877341	missense	probably benign	0.03
Z1176:Uhrf1bp1	UTSW	17	27876676	missense	probably damaging	1.00
Z1176:Uhrf1bp1	UTSW	17	27886306	missense	probably damaging	1.00
Z1177:Uhrf1bp1	UTSW	17	27884966	missense	not run

Predicted Primers

PCR Primer
(F):5'- ACAAGCGTCTTGGATGATAGTGGC -3'
(R):5'- GGATTCGCAGACATCTTCCCCAAC -3'

Sequencing Primer
(F):5'- GAGCCCTGTTACGGATAGTG -3'
(R):5'- ACAACTGTGTGGCCTACAGC -3'

Posted On

2014-01-05