Incidental Mutation 'R1015:Olfr1034'
ID96103
Institutional Source Beutler Lab
Gene Symbol Olfr1034
Ensembl Gene ENSMUSG00000102091
Gene Nameolfactory receptor 1034
SynonymsGA_x6K02T2Q125-47521463-47522395, MOR227-8P, MOR227-8P, Olfr1533-ps1, MOR245-14P
MMRRC Submission 039119-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R1015 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86045861-86050742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86047082 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 200 (I200T)
Ref Sequence ENSEMBL: ENSMUSP00000078279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079298] [ENSMUST00000213496] [ENSMUST00000213865] [ENSMUST00000214546] [ENSMUST00000215682] [ENSMUST00000218397]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079298
AA Change: I200T

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078279
Gene: ENSMUSG00000042796
AA Change: I200T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-50 PFAM
Pfam:7tm_1 39 288 9.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213364
Predicted Effect probably benign
Transcript: ENSMUST00000213496
AA Change: I200T

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000213865
Predicted Effect probably benign
Transcript: ENSMUST00000214546
Predicted Effect probably benign
Transcript: ENSMUST00000215682
Predicted Effect probably benign
Transcript: ENSMUST00000218397
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3d1 A G 10: 80,716,489 V615A probably damaging Het
Atp6v1d A G 12: 78,849,769 V108A possibly damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt6 C A 7: 98,194,595 V53L probably benign Het
C8b A G 4: 104,786,960 K275E probably benign Het
Cage1 T A 13: 38,016,475 N683I possibly damaging Het
Celsr3 T C 9: 108,833,176 V1535A probably benign Het
Cep120 C T 18: 53,703,121 probably null Het
Cep135 T C 5: 76,640,997 probably null Het
Chd9 T A 8: 90,932,578 H55Q probably damaging Het
Dmxl2 G A 9: 54,367,765 T2915I probably benign Het
Eps8l1 A T 7: 4,469,933 D118V probably damaging Het
Galnt2 C T 8: 124,336,617 H359Y probably benign Het
Gm8765 T G 13: 50,701,628 V434G possibly damaging Het
Gm884 T C 11: 103,545,796 H754R probably benign Het
Kdm5d T C Y: 941,687 V1296A possibly damaging Het
Kif27 T A 13: 58,320,215 K849N probably damaging Het
Kif5c T A 2: 49,744,365 D736E probably benign Het
Krt18 T C 15: 102,031,300 I311T probably benign Het
Lamc2 A T 1: 153,166,199 V63D possibly damaging Het
Lmbrd1 T A 1: 24,731,878 C295* probably null Het
Map3k14 T A 11: 103,225,300 Q767H probably damaging Het
Mapkapk5 T C 5: 121,533,362 K203E probably benign Het
Mcc C A 18: 44,724,669 L126F probably benign Het
Mib1 T A 18: 10,726,409 H35Q probably damaging Het
Myo16 A G 8: 10,390,183 N412D probably benign Het
Ndst2 T C 14: 20,730,064 Y36C probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nwd2 T C 5: 63,806,811 I1246T probably damaging Het
Olfr74 T C 2: 87,974,087 T193A probably benign Het
Patl1 T C 19: 11,920,373 V108A probably benign Het
Pdzd2 T C 15: 12,374,508 E1847G probably damaging Het
Pla2g2f C T 4: 138,754,268 V57I probably benign Het
Prag1 T C 8: 36,146,543 V1083A probably damaging Het
Slc3a2 C T 19: 8,707,955 W227* probably null Het
Snx9 A G 17: 5,920,127 I379M probably benign Het
Tacc2 A G 7: 130,624,065 K846E probably benign Het
Taf4b T A 18: 14,813,098 V326E probably damaging Het
Tnrc6c C T 11: 117,721,922 S462F possibly damaging Het
Trim66 C T 7: 109,455,233 V1257I probably damaging Het
Urb2 T C 8: 124,029,434 Y627H probably damaging Het
Usp53 A G 3: 122,933,759 L1058P probably benign Het
Wdr24 A G 17: 25,828,238 S702G probably benign Het
Other mutations in Olfr1034
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Olfr1034 APN 2 86046652 missense possibly damaging 0.55
IGL01066:Olfr1034 APN 2 86047258 missense probably damaging 0.97
IGL01326:Olfr1034 APN 2 86047283 missense probably damaging 0.96
IGL02862:Olfr1034 APN 2 86047304 missense probably benign 0.07
ANU74:Olfr1034 UTSW 2 86047311 nonsense probably null
PIT4651001:Olfr1034 UTSW 2 86046518 missense probably damaging 1.00
R0415:Olfr1034 UTSW 2 86047055 missense probably benign 0.00
R0492:Olfr1034 UTSW 2 86046587 missense probably benign 0.00
R0492:Olfr1034 UTSW 2 86046934 missense possibly damaging 0.81
R0517:Olfr1034 UTSW 2 86047204 missense probably damaging 0.99
R0519:Olfr1034 UTSW 2 86047067 missense probably benign
R0619:Olfr1034 UTSW 2 86047311 nonsense probably null
R1592:Olfr1034 UTSW 2 86046989 missense probably benign 0.00
R1598:Olfr1034 UTSW 2 86047313 missense probably damaging 0.99
R2062:Olfr1034 UTSW 2 86046955 missense probably damaging 1.00
R4690:Olfr1034 UTSW 2 86046898 missense probably damaging 1.00
R5757:Olfr1034 UTSW 2 86046566 missense possibly damaging 0.93
R5991:Olfr1034 UTSW 2 86046910 missense probably benign 0.05
R6037:Olfr1034 UTSW 2 86046584 missense probably benign 0.00
R6037:Olfr1034 UTSW 2 86046584 missense probably benign 0.00
R6760:Olfr1034 UTSW 2 86047014 nonsense probably null
R6852:Olfr1034 UTSW 2 86046604 missense probably benign 0.28
S24628:Olfr1034 UTSW 2 86047055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTCCAGGGTTGTCTGTATCCGC -3'
(R):5'- GGGGTTCAGCATAGGAATCACACTG -3'

Sequencing Primer
(F):5'- TGTATCCGCCTCATTTCTGTG -3'
(R):5'- CACAGACTCCTCCGTTGG -3'
Posted On2014-01-05