Incidental Mutation 'R1126:Zp3r'
ID96116
Institutional Source Beutler Lab
Gene Symbol Zp3r
Ensembl Gene ENSMUSG00000042554
Gene Namezona pellucida 3 receptor
SynonymsSP56
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location130576713-130629621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130618342 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 77 (L77P)
Ref Sequence ENSEMBL: ENSMUSP00000118784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039862] [ENSMUST00000128128] [ENSMUST00000142416]
Predicted Effect probably damaging
Transcript: ENSMUST00000039862
AA Change: L77P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045443
Gene: ENSMUSG00000042554
AA Change: L77P

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 91 2.52e-7 SMART
CCP 96 153 3.17e-13 SMART
CCP 158 218 8.23e-12 SMART
CCP 223 278 1.77e-11 SMART
CCP 283 345 5.32e-6 SMART
CCP 350 411 3.67e-9 SMART
CCP 456 509 6.95e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128128
AA Change: L98P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114401
Gene: ENSMUSG00000042554
AA Change: L98P

DomainStartEndE-ValueType
CCP 55 112 2.52e-7 SMART
CCP 117 174 3.17e-13 SMART
CCP 179 234 1.77e-11 SMART
CCP 239 301 5.32e-6 SMART
CCP 306 367 3.67e-9 SMART
CCP 412 465 6.95e-10 SMART
PDB:4B0F|G 468 513 8e-8 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000142416
AA Change: L77P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118784
Gene: ENSMUSG00000042554
AA Change: L77P

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CCP 34 91 2.52e-7 SMART
CCP 96 153 3.17e-13 SMART
CCP 158 213 1.77e-11 SMART
CCP 218 280 5.32e-6 SMART
CCP 285 346 3.67e-9 SMART
CCP 391 444 6.95e-10 SMART
PDB:4B0F|G 447 492 8e-8 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility and sperm morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Other mutations in Zp3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Zp3r APN 1 130619356 missense possibly damaging 0.88
IGL01783:Zp3r APN 1 130598866 missense possibly damaging 0.72
IGL01820:Zp3r APN 1 130598920 missense probably benign 0.01
IGL01959:Zp3r APN 1 130591451 nonsense probably null
IGL01978:Zp3r APN 1 130598941 missense probably damaging 1.00
IGL02232:Zp3r APN 1 130596667 missense probably damaging 1.00
IGL02290:Zp3r APN 1 130619365 missense possibly damaging 0.89
IGL02878:Zp3r APN 1 130582851 missense probably benign 0.02
IGL02960:Zp3r APN 1 130583438 missense possibly damaging 0.67
BB006:Zp3r UTSW 1 130591480 missense probably benign 0.31
BB016:Zp3r UTSW 1 130591480 missense probably benign 0.31
PIT4403001:Zp3r UTSW 1 130582872 missense possibly damaging 0.93
R0433:Zp3r UTSW 1 130577133 splice site probably benign
R0491:Zp3r UTSW 1 130618334 missense probably damaging 1.00
R0781:Zp3r UTSW 1 130577884 critical splice donor site probably null
R1110:Zp3r UTSW 1 130577884 critical splice donor site probably null
R1295:Zp3r UTSW 1 130591444 missense probably damaging 1.00
R1680:Zp3r UTSW 1 130582880 missense probably benign 0.15
R1728:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1728:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1729:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1729:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1730:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1730:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1739:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1739:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1762:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1762:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1783:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1783:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1784:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1784:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R1785:Zp3r UTSW 1 130596814 missense probably benign 0.00
R1785:Zp3r UTSW 1 130619414 missense possibly damaging 0.68
R3942:Zp3r UTSW 1 130577054 missense possibly damaging 0.94
R4429:Zp3r UTSW 1 130591391 missense possibly damaging 0.95
R4571:Zp3r UTSW 1 130578020 missense probably damaging 1.00
R4626:Zp3r UTSW 1 130615175 missense probably damaging 1.00
R4647:Zp3r UTSW 1 130577960 missense probably damaging 1.00
R4790:Zp3r UTSW 1 130582892 missense probably damaging 1.00
R4815:Zp3r UTSW 1 130598912 missense probably damaging 1.00
R5355:Zp3r UTSW 1 130596781 missense probably benign 0.09
R5554:Zp3r UTSW 1 130583471 missense probably benign 0.42
R5629:Zp3r UTSW 1 130582879 missense probably damaging 0.99
R6154:Zp3r UTSW 1 130598905 missense probably damaging 1.00
R6173:Zp3r UTSW 1 130591568 splice site probably null
R6949:Zp3r UTSW 1 130577895 missense probably benign 0.00
R7346:Zp3r UTSW 1 130583480 missense probably benign 0.02
R7399:Zp3r UTSW 1 130577053 missense probably damaging 0.98
R7929:Zp3r UTSW 1 130591480 missense probably benign 0.31
R7944:Zp3r UTSW 1 130596823 missense probably damaging 1.00
R7945:Zp3r UTSW 1 130596823 missense probably damaging 1.00
R8367:Zp3r UTSW 1 130598873 missense probably damaging 1.00
R8742:Zp3r UTSW 1 130583493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTGCCAACTGTCCTTTTCCAAA -3'
(R):5'- CGTGGTCCTTGCTCCGTAAACCTTA -3'

Sequencing Primer
(F):5'- gccatctcttcagcccc -3'
(R):5'- GAGATTCTCTCTCTCAAGGTTCAG -3'
Posted On2014-01-05