Incidental Mutation 'R1126:Kdm5b'
ID 96118
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine (K)-specific demethylase 5B
Synonyms Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock # R1126 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 134560171-134635285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 134613991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 768 (A768V)
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
PDB Structure Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047714
AA Change: A768V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: A768V

low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112198
AA Change: A768V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: A768V

low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134604497 missense probably benign 0.14
R7426:Kdm5b UTSW 1 134595833 missense probably benign 0.02
R7452:Kdm5b UTSW 1 134624948 missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134608966 missense probably benign 0.00
R7612:Kdm5b UTSW 1 134624918 nonsense probably null
R7704:Kdm5b UTSW 1 134587931 missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134617840 missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134619673 missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134625126 missense probably benign 0.05
R8160:Kdm5b UTSW 1 134613919 missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134613926 missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134607768 missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134600755 critical splice donor site probably null
R9133:Kdm5b UTSW 1 134602585 missense probably benign
R9298:Kdm5b UTSW 1 134600755 critical splice donor site probably null
R9423:Kdm5b UTSW 1 134587967 missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134585233 critical splice donor site probably null
R9670:Kdm5b UTSW 1 134630502 nonsense probably null
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134625035 missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134595798 frame shift probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgaaacaccaaagtccagtcc -3'
Posted On 2014-01-05