Incidental Mutation 'R1126:Olfr365'
ID96124
Institutional Source Beutler Lab
Gene Symbol Olfr365
Ensembl Gene ENSMUSG00000059429
Gene Nameolfactory receptor 365
SynonymsGA_x6K02T2NLDC-33885305-33886243, MOR138-1
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37188198-37206019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37202101 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 287 (M287L)
Ref Sequence ENSEMBL: ENSMUSP00000151617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074168] [ENSMUST00000213969] [ENSMUST00000218602]
Predicted Effect probably benign
Transcript: ENSMUST00000074168
AA Change: M287L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073801
Gene: ENSMUSG00000059429
AA Change: M287L

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
Pfam:7tm_4 33 309 4.7e-58 PFAM
Pfam:7tm_1 43 292 2.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120111
Predicted Effect probably benign
Transcript: ENSMUST00000213969
AA Change: M287L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218602
AA Change: M287L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Olfr365
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Olfr365 APN 2 37201597 missense probably damaging 1.00
IGL00943:Olfr365 APN 2 37202171 missense probably benign 0.08
IGL01100:Olfr365 APN 2 37201640 missense possibly damaging 0.58
IGL01696:Olfr365 APN 2 37201511 missense probably benign 0.00
IGL02119:Olfr365 APN 2 37201269 missense possibly damaging 0.73
IGL02807:Olfr365 APN 2 37201574 missense probably damaging 1.00
IGL03030:Olfr365 APN 2 37201871 missense probably benign 0.00
R0388:Olfr365 UTSW 2 37202184 splice site probably null
R0788:Olfr365 UTSW 2 37202023 missense possibly damaging 0.90
R1753:Olfr365 UTSW 2 37201427 missense probably damaging 1.00
R1822:Olfr365 UTSW 2 37201980 missense probably damaging 1.00
R1837:Olfr365 UTSW 2 37202102 missense probably benign 0.23
R3711:Olfr365 UTSW 2 37201273 missense probably benign
R4077:Olfr365 UTSW 2 37202012 missense possibly damaging 0.79
R4078:Olfr365 UTSW 2 37202012 missense possibly damaging 0.79
R4375:Olfr365 UTSW 2 37201562 missense probably benign 0.33
R4607:Olfr365 UTSW 2 37202082 nonsense probably null
R4608:Olfr365 UTSW 2 37202082 nonsense probably null
R4889:Olfr365 UTSW 2 37202045 missense probably damaging 1.00
R5398:Olfr365 UTSW 2 37201318 missense probably benign 0.33
R5560:Olfr365 UTSW 2 37201930 missense probably benign 0.01
R5670:Olfr365 UTSW 2 37201994 missense probably benign 0.19
R6108:Olfr365 UTSW 2 37201766 missense possibly damaging 0.68
R6727:Olfr365 UTSW 2 37202106 missense probably damaging 1.00
R6860:Olfr365 UTSW 2 37202177 missense possibly damaging 0.96
R7079:Olfr365 UTSW 2 37202173 missense probably benign 0.00
R7113:Olfr365 UTSW 2 37201556 missense possibly damaging 0.74
R7278:Olfr365 UTSW 2 37202080 missense probably damaging 1.00
R7731:Olfr365 UTSW 2 37201549 missense probably benign 0.07
R8096:Olfr365 UTSW 2 37202066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTGTCACTGTGCTCAGGATTCCC -3'
(R):5'- GGCACCATGTAGTACATGATGTGGTTT -3'

Sequencing Primer
(F):5'- GTGCTCAGGATTCCCTCTGC -3'
(R):5'- gtgtgtgtctgtttgtctctg -3'
Posted On2014-01-05