Incidental Mutation 'R1126:Rag1'
ID96128
Institutional Source Beutler Lab
Gene Symbol Rag1
Ensembl Gene ENSMUSG00000061311
Gene Namerecombination activating gene 1
SynonymsRag-1
MMRRC Submission 039199-MU
Accession Numbers

MGI:97848

Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location101638282-101649501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101642689 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 703 (R703G)
Ref Sequence ENSEMBL: ENSMUSP00000077584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078494] [ENSMUST00000160037] [ENSMUST00000160722]
PDB Structure RAG1 DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the core RAG1/2 recombinase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000078494
AA Change: R703G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077584
Gene: ENSMUSG00000061311
AA Change: R703G

DomainStartEndE-ValueType
Pfam:RAG1_imp_bd 11 288 5.7e-120 PFAM
RING 290 328 1.39e-3 SMART
ZnF_C2H2 353 376 2.61e1 SMART
PDB:3GNB|A 389 464 3e-44 PDB
ZnF_C2H2 725 750 7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in activation of immunoglobulin V-D-J recombination. The encoded protein is involved in recognition of the DNA substrate, but stable binding and cleavage activity also requires RAG2. Defects in this gene can be the cause of several diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(10) Chemically induced(3)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Rag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rag1 APN 2 101642388 missense probably damaging 1.00
IGL01125:Rag1 APN 2 101642001 missense probably damaging 0.99
IGL01836:Rag1 APN 2 101641894 missense probably damaging 1.00
IGL02216:Rag1 APN 2 101643381 missense possibly damaging 0.91
IGL02271:Rag1 APN 2 101643388 missense probably damaging 0.99
IGL02293:Rag1 APN 2 101643046 missense probably benign 0.39
IGL02601:Rag1 APN 2 101642673 missense probably damaging 1.00
Anne UTSW 2 101643516 missense probably damaging 0.99
busted UTSW 2 101641947 missense probably damaging 1.00
cloth UTSW 2 101642664 missense probably damaging 1.00
defective UTSW 2 101642710 missense probably damaging 1.00
doll UTSW 2 101642070 missense probably damaging 1.00
dysfunctional UTSW 2 101644284 missense probably damaging 1.00
huckle UTSW 2 101641223 intron probably benign
maladaptive UTSW 2 101645647 intron probably benign
scarecrow UTSW 2 101642507 missense probably damaging 1.00
R0658:Rag1 UTSW 2 101642683 missense probably damaging 0.99
R1177:Rag1 UTSW 2 101642278 missense probably benign 0.10
R1319:Rag1 UTSW 2 101643192 missense probably damaging 1.00
R1513:Rag1 UTSW 2 101642991 missense possibly damaging 0.95
R1859:Rag1 UTSW 2 101644062 missense probably benign 0.03
R2218:Rag1 UTSW 2 101644146 missense probably benign
R3932:Rag1 UTSW 2 101643039 missense probably damaging 1.00
R4127:Rag1 UTSW 2 101642071 missense probably damaging 1.00
R4365:Rag1 UTSW 2 101642943 missense probably damaging 1.00
R4620:Rag1 UTSW 2 101643680 missense probably damaging 1.00
R4815:Rag1 UTSW 2 101643516 missense probably damaging 0.99
R5070:Rag1 UTSW 2 101642311 missense probably damaging 1.00
R5209:Rag1 UTSW 2 101644215 missense probably benign 0.01
R5239:Rag1 UTSW 2 101642955 missense possibly damaging 0.91
R5390:Rag1 UTSW 2 101642734 missense probably benign
R5607:Rag1 UTSW 2 101643792 missense probably damaging 1.00
R6259:Rag1 UTSW 2 101644452 missense possibly damaging 0.83
R6412:Rag1 UTSW 2 101642520 missense probably damaging 0.99
R6633:Rag1 UTSW 2 101642710 missense probably damaging 1.00
R6679:Rag1 UTSW 2 101644284 missense probably damaging 1.00
R6723:Rag1 UTSW 2 101643645 missense probably damaging 0.99
R6853:Rag1 UTSW 2 101642221 missense probably damaging 0.99
R6867:Rag1 UTSW 2 101641947 missense probably damaging 1.00
R6974:Rag1 UTSW 2 101641792 missense probably damaging 0.99
R7071:Rag1 UTSW 2 101643462 missense probably damaging 0.99
R7124:Rag1 UTSW 2 101643783 missense probably damaging 0.99
R7248:Rag1 UTSW 2 101641778 missense probably damaging 0.99
R7256:Rag1 UTSW 2 101642070 missense probably damaging 1.00
R7567:Rag1 UTSW 2 101643661 missense probably damaging 0.98
R7581:Rag1 UTSW 2 101643304 missense possibly damaging 0.95
R7830:Rag1 UTSW 2 101642059 missense probably damaging 1.00
R7941:Rag1 UTSW 2 101642346 missense probably benign 0.24
R8024:Rag1 UTSW 2 101642507 missense probably damaging 1.00
R8434:Rag1 UTSW 2 101642664 missense probably damaging 1.00
R8688:Rag1 UTSW 2 101642623 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101643597 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101644547 missense probably damaging 0.99
Z1176:Rag1 UTSW 2 101643259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAAAGGTTTGGCAGAGACCCC -3'
(R):5'- TCACAGAACGTGAAGGTGTTTGAGG -3'

Sequencing Primer
(F):5'- TTCCACGGACTCATGATACGG -3'
(R):5'- TGTTTGAGGAACCCAAGCC -3'
Posted On2014-01-05