Incidental Mutation 'R1126:Rmdn3'
ID96130
Institutional Source Beutler Lab
Gene Symbol Rmdn3
Ensembl Gene ENSMUSG00000070730
Gene Nameregulator of microtubule dynamics 3
Synonyms
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119137001-119157034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119153995 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 92 (D92G)
Ref Sequence ENSEMBL: ENSMUSP00000092283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094695] [ENSMUST00000129351] [ENSMUST00000135419] [ENSMUST00000139519]
Predicted Effect probably benign
Transcript: ENSMUST00000094695
AA Change: D92G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000092283
Gene: ENSMUSG00000070730
AA Change: D92G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 91 122 N/A INTRINSIC
low complexity region 135 148 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
SCOP:d1hxia_ 354 445 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129351
SMART Domains Protein: ENSMUSP00000119498
Gene: ENSMUSG00000070730

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135419
SMART Domains Protein: ENSMUSP00000123373
Gene: ENSMUSG00000070730

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139519
SMART Domains Protein: ENSMUSP00000115973
Gene: ENSMUSG00000070730

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Rmdn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Rmdn3 APN 2 119153947 missense probably damaging 1.00
IGL01684:Rmdn3 APN 2 119147574 missense probably damaging 1.00
IGL02892:Rmdn3 APN 2 119154080 missense probably benign 0.00
R0534:Rmdn3 UTSW 2 119146370 missense probably benign 0.00
R2332:Rmdn3 UTSW 2 119153527 unclassified probably benign
R3850:Rmdn3 UTSW 2 119156422 missense possibly damaging 0.65
R5034:Rmdn3 UTSW 2 119147577 missense probably damaging 1.00
R5221:Rmdn3 UTSW 2 119156454 missense probably damaging 1.00
R5942:Rmdn3 UTSW 2 119147577 missense probably damaging 1.00
R6049:Rmdn3 UTSW 2 119153425 missense probably damaging 1.00
R6188:Rmdn3 UTSW 2 119139350 critical splice donor site probably null
R7011:Rmdn3 UTSW 2 119138423 missense probably damaging 1.00
R7181:Rmdn3 UTSW 2 119139368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATAGGCCAAAGGGCACAGC -3'
(R):5'- AGGAAATGGCCCAGCTCATGTCTC -3'

Sequencing Primer
(F):5'- TGGGCTTGTTTAGAACCACAAAG -3'
(R):5'- gtccaatcccagccccc -3'
Posted On2014-01-05