Incidental Mutation 'R1126:Penk'
ID96138
Institutional Source Beutler Lab
Gene Symbol Penk
Ensembl Gene ENSMUSG00000045573
Gene Namepreproenkephalin
SynonymsENK, Penk, Penk1, PPA
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location4133531-4138819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4138119 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 9 (T9A)
Ref Sequence ENSEMBL: ENSMUSP00000122389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070375] [ENSMUST00000133567]
Predicted Effect probably benign
Transcript: ENSMUST00000070375
AA Change: T9A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066822
Gene: ENSMUSG00000045573
AA Change: T9A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Opiods_neuropep 25 70 1.5e-19 PFAM
internal_repeat_1 90 141 4.19e-10 PROSPERO
internal_repeat_1 201 267 4.19e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131498
Predicted Effect probably benign
Transcript: ENSMUST00000133567
AA Change: T9A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122389
Gene: ENSMUSG00000045573
AA Change: T9A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Opiods_neuropep 25 72 3.2e-23 PFAM
Blast:CYCc 108 176 1e-16 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit nitrituria. Female homozygotes display decreased circulating triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Penk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Penk APN 4 4134347 missense probably damaging 1.00
IGL01901:Penk APN 4 4134465 missense probably benign 0.02
IGL02634:Penk APN 4 4134065 missense possibly damaging 0.92
IGL02935:Penk APN 4 4133843 missense probably damaging 0.99
R0712:Penk UTSW 4 4134257 missense probably benign 0.35
R1331:Penk UTSW 4 4134287 missense probably benign 0.02
R1720:Penk UTSW 4 4134240 missense probably damaging 1.00
R2181:Penk UTSW 4 4134041 unclassified probably null
R3154:Penk UTSW 4 4134152 missense probably damaging 0.96
R5184:Penk UTSW 4 4134296 missense probably damaging 1.00
R5779:Penk UTSW 4 4134318 missense probably damaging 1.00
R5939:Penk UTSW 4 4138010 missense probably benign 0.01
R7860:Penk UTSW 4 4133976 missense possibly damaging 0.48
R7943:Penk UTSW 4 4133976 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGGTAACTTTGGTCCACAAAGGCTC -3'
(R):5'- TGTCATCAGGAAAACAGGACTCCCC -3'

Sequencing Primer
(F):5'- CAAAGGCTCCTGCCACG -3'
(R):5'- ACTAGGGTCCAAGCTCTCATTG -3'
Posted On2014-01-05