Incidental Mutation 'R1126:Saxo1'
ID96142
Institutional Source Beutler Lab
Gene Symbol Saxo1
Ensembl Gene ENSMUSG00000028492
Gene Namestabilizer of axonemal microtubules 1
Synonyms4930500O09Rik, Fam154a
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location86444641-86558328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86478987 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 105 (T105S)
Ref Sequence ENSEMBL: ENSMUSP00000030216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030216]
Predicted Effect probably benign
Transcript: ENSMUST00000030216
AA Change: T105S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030216
Gene: ENSMUSG00000028492
AA Change: T105S

DomainStartEndE-ValueType
Pfam:STOP 5 129 2.4e-13 PFAM
Pfam:STOP 88 265 1.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151481
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Saxo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL00563:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL01816:Saxo1 APN 4 86445614 missense probably benign 0.03
IGL02941:Saxo1 APN 4 86445584 missense probably damaging 1.00
IGL03139:Saxo1 APN 4 86487762 missense possibly damaging 0.49
R0498:Saxo1 UTSW 4 86478896 missense possibly damaging 0.78
R0522:Saxo1 UTSW 4 86445103 missense probably damaging 1.00
R2203:Saxo1 UTSW 4 86445761 missense probably damaging 1.00
R2261:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R2262:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R4017:Saxo1 UTSW 4 86557996 missense possibly damaging 0.82
R4629:Saxo1 UTSW 4 86487827 missense probably damaging 1.00
R5199:Saxo1 UTSW 4 86487782 missense probably damaging 1.00
R5471:Saxo1 UTSW 4 86445724 missense probably damaging 1.00
R5626:Saxo1 UTSW 4 86445589 missense probably damaging 1.00
R5679:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R5710:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R5782:Saxo1 UTSW 4 86445807 missense probably damaging 0.96
R6900:Saxo1 UTSW 4 86445334 missense possibly damaging 0.94
R7035:Saxo1 UTSW 4 86445122 missense probably damaging 1.00
R7491:Saxo1 UTSW 4 86445407 missense probably benign 0.27
Z1176:Saxo1 UTSW 4 86445803 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATGTACCCGCCAACGGTGAAC -3'
(R):5'- TGTTAATACGAGCCAAGGGGACAAC -3'

Sequencing Primer
(F):5'- agccattcttagcttcccatc -3'
(R):5'- GGACAACACTGTCTTTTTTCTGAG -3'
Posted On2014-01-05