Incidental Mutation 'R1126:Nlrp9a'
ID96160
Institutional Source Beutler Lab
Gene Symbol Nlrp9a
Ensembl Gene ENSMUSG00000054102
Gene NameNLR family, pyrin domain containing 9A
SynonymsNalp9a, Nalp-theta, D7Ertd565e
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26535023-26575615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26560741 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 640 (D640E)
Ref Sequence ENSEMBL: ENSMUSP00000104024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071780] [ENSMUST00000108387] [ENSMUST00000117252] [ENSMUST00000122040] [ENSMUST00000153452]
Predicted Effect probably benign
Transcript: ENSMUST00000071780
SMART Domains Protein: ENSMUSP00000071685
Gene: ENSMUSG00000054102

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108387
AA Change: D640E

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104024
Gene: ENSMUSG00000054102
AA Change: D640E

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 7.7e-33 PFAM
LRR 631 658 1.42e0 SMART
LRR 692 719 1.42e0 SMART
LRR 748 775 2.32e-1 SMART
LRR 777 804 3e0 SMART
LRR 805 832 1.12e-3 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.27e-4 SMART
LRR 891 918 2.02e2 SMART
LRR 919 946 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117252
SMART Domains Protein: ENSMUSP00000112398
Gene: ENSMUSG00000054102

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 8.8e-34 PFAM
LRR 637 664 1.42e0 SMART
Blast:LRR 666 692 1e-5 BLAST
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.39e0 SMART
LRR 807 834 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122040
SMART Domains Protein: ENSMUSP00000113318
Gene: ENSMUSG00000054102

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143149
Predicted Effect probably benign
Transcript: ENSMUST00000153452
AA Change: D551E

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120498
Gene: ENSMUSG00000054102
AA Change: D551E

DomainStartEndE-ValueType
Pfam:NACHT 54 222 6.9e-33 PFAM
LRR 542 569 1.42e0 SMART
LRR 603 630 1.42e0 SMART
Blast:LRR 632 657 1e-5 BLAST
LRR 659 686 2.32e-1 SMART
LRR 688 715 3e0 SMART
LRR 716 743 1.12e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Nlrp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Nlrp9a APN 7 26557625 missense probably benign 0.22
IGL00895:Nlrp9a APN 7 26558678 missense probably benign
IGL01081:Nlrp9a APN 7 26558094 missense possibly damaging 0.51
IGL01148:Nlrp9a APN 7 26557581 missense probably damaging 1.00
IGL01368:Nlrp9a APN 7 26557874 missense probably damaging 1.00
IGL01914:Nlrp9a APN 7 26557264 missense probably benign 0.01
IGL01952:Nlrp9a APN 7 26558019 missense probably benign 0.01
IGL02245:Nlrp9a APN 7 26557893 missense probably benign 0.02
IGL02449:Nlrp9a APN 7 26564971 missense probably benign 0.00
IGL02702:Nlrp9a APN 7 26564956 missense possibly damaging 0.67
IGL02944:Nlrp9a APN 7 26558651 missense probably benign 0.28
IGL03183:Nlrp9a APN 7 26557457 missense probably damaging 1.00
R0005:Nlrp9a UTSW 7 26573788 splice site probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0013:Nlrp9a UTSW 7 26571225 splice site probably null
R0086:Nlrp9a UTSW 7 26558547 missense probably damaging 0.98
R0659:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R1500:Nlrp9a UTSW 7 26567891 missense probably benign 0.01
R1585:Nlrp9a UTSW 7 26558668 missense probably benign 0.41
R1594:Nlrp9a UTSW 7 26570507 nonsense probably null
R1968:Nlrp9a UTSW 7 26564941 missense probably benign 0.23
R1989:Nlrp9a UTSW 7 26573913 missense probably benign 0.24
R2057:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2058:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2059:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2188:Nlrp9a UTSW 7 26564929 missense probably damaging 1.00
R2318:Nlrp9a UTSW 7 26573852 missense probably damaging 0.98
R3110:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3112:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3237:Nlrp9a UTSW 7 26571385 nonsense probably null
R3545:Nlrp9a UTSW 7 26557332 missense probably benign 0.03
R3805:Nlrp9a UTSW 7 26564852 nonsense probably null
R4005:Nlrp9a UTSW 7 26558550 missense probably benign 0.02
R4057:Nlrp9a UTSW 7 26570646 missense probably benign 0.00
R4529:Nlrp9a UTSW 7 26571407 missense probably damaging 1.00
R4756:Nlrp9a UTSW 7 26557441 missense probably damaging 1.00
R4908:Nlrp9a UTSW 7 26550944 missense probably damaging 1.00
R4972:Nlrp9a UTSW 7 26570539 missense probably damaging 1.00
R4992:Nlrp9a UTSW 7 26557386 missense probably benign 0.00
R5042:Nlrp9a UTSW 7 26571278 missense probably damaging 1.00
R5224:Nlrp9a UTSW 7 26557292 missense probably benign 0.43
R5449:Nlrp9a UTSW 7 26557829 missense probably benign 0.04
R5644:Nlrp9a UTSW 7 26558568 missense possibly damaging 0.51
R5734:Nlrp9a UTSW 7 26570640 missense probably damaging 1.00
R5905:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R5978:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R6028:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R6066:Nlrp9a UTSW 7 26558085 missense probably benign 0.00
R6082:Nlrp9a UTSW 7 26567977 missense probably benign 0.41
R6171:Nlrp9a UTSW 7 26558763 missense possibly damaging 0.71
R6352:Nlrp9a UTSW 7 26557626 missense probably damaging 1.00
R6490:Nlrp9a UTSW 7 26550886 missense probably damaging 1.00
R6540:Nlrp9a UTSW 7 26557392 missense possibly damaging 0.88
R7039:Nlrp9a UTSW 7 26567942 missense probably benign 0.03
R7151:Nlrp9a UTSW 7 26557247 nonsense probably null
R7173:Nlrp9a UTSW 7 26558178 missense probably benign 0.00
R7214:Nlrp9a UTSW 7 26551038 missense probably damaging 0.98
R7226:Nlrp9a UTSW 7 26558724 missense probably benign 0.02
R7250:Nlrp9a UTSW 7 26558718 missense possibly damaging 0.78
R7293:Nlrp9a UTSW 7 26571269 missense probably damaging 1.00
R7492:Nlrp9a UTSW 7 26557656 missense probably damaging 0.99
R7586:Nlrp9a UTSW 7 26557296 missense possibly damaging 0.83
R7844:Nlrp9a UTSW 7 26562581 missense possibly damaging 0.82
R8073:Nlrp9a UTSW 7 26560835 missense probably damaging 0.98
R8136:Nlrp9a UTSW 7 26557253 missense probably benign 0.34
R8400:Nlrp9a UTSW 7 26565006 missense probably benign 0.02
R8415:Nlrp9a UTSW 7 26557500 missense probably benign
R8774:Nlrp9a UTSW 7 26558559 missense possibly damaging 0.95
R8774-TAIL:Nlrp9a UTSW 7 26558559 missense possibly damaging 0.95
R8882:Nlrp9a UTSW 7 26558278 nonsense probably null
Z1176:Nlrp9a UTSW 7 26558229 missense probably damaging 1.00
Z1177:Nlrp9a UTSW 7 26557456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTTTTGAGAAGGGGTTGAGAGTGAT -3'
(R):5'- GCCAAACTTAGGCCAGGGCA -3'

Sequencing Primer
(F):5'- GGGTTGAGAGTGATGTGCC -3'
(R):5'- cacacacacacacacacacac -3'
Posted On2014-01-05