Incidental Mutation 'R1015:Urb2'
ID96161
Institutional Source Beutler Lab
Gene Symbol Urb2
Ensembl Gene ENSMUSG00000031976
Gene NameURB2 ribosome biogenesis 2 homolog (S. cerevisiae)
Synonyms
MMRRC Submission 039119-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1015 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location124021508-124048505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124029434 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 627 (Y627H)
Ref Sequence ENSEMBL: ENSMUSP00000133547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034457] [ENSMUST00000127664] [ENSMUST00000173168]
Predicted Effect probably damaging
Transcript: ENSMUST00000034457
AA Change: Y627H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034457
Gene: ENSMUSG00000031976
AA Change: Y627H

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
low complexity region 1273 1279 N/A INTRINSIC
Pfam:Urb2 1319 1515 2.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173168
AA Change: Y627H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133547
Gene: ENSMUSG00000031976
AA Change: Y627H

DomainStartEndE-ValueType
low complexity region 489 503 N/A INTRINSIC
low complexity region 541 546 N/A INTRINSIC
low complexity region 576 590 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
low complexity region 1073 1092 N/A INTRINSIC
low complexity region 1172 1188 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212460
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3d1 A G 10: 80,716,489 V615A probably damaging Het
Atp6v1d A G 12: 78,849,769 V108A possibly damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt6 C A 7: 98,194,595 V53L probably benign Het
C8b A G 4: 104,786,960 K275E probably benign Het
Cage1 T A 13: 38,016,475 N683I possibly damaging Het
Celsr3 T C 9: 108,833,176 V1535A probably benign Het
Cep120 C T 18: 53,703,121 probably null Het
Cep135 T C 5: 76,640,997 probably null Het
Chd9 T A 8: 90,932,578 H55Q probably damaging Het
Dmxl2 G A 9: 54,367,765 T2915I probably benign Het
Eps8l1 A T 7: 4,469,933 D118V probably damaging Het
Galnt2 C T 8: 124,336,617 H359Y probably benign Het
Gm8765 T G 13: 50,701,628 V434G possibly damaging Het
Gm884 T C 11: 103,545,796 H754R probably benign Het
Kdm5d T C Y: 941,687 V1296A possibly damaging Het
Kif27 T A 13: 58,320,215 K849N probably damaging Het
Kif5c T A 2: 49,744,365 D736E probably benign Het
Krt18 T C 15: 102,031,300 I311T probably benign Het
Lamc2 A T 1: 153,166,199 V63D possibly damaging Het
Lmbrd1 T A 1: 24,731,878 C295* probably null Het
Map3k14 T A 11: 103,225,300 Q767H probably damaging Het
Mapkapk5 T C 5: 121,533,362 K203E probably benign Het
Mcc C A 18: 44,724,669 L126F probably benign Het
Mib1 T A 18: 10,726,409 H35Q probably damaging Het
Myo16 A G 8: 10,390,183 N412D probably benign Het
Ndst2 T C 14: 20,730,064 Y36C probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nwd2 T C 5: 63,806,811 I1246T probably damaging Het
Olfr1034 T C 2: 86,047,082 I200T possibly damaging Het
Olfr74 T C 2: 87,974,087 T193A probably benign Het
Patl1 T C 19: 11,920,373 V108A probably benign Het
Pdzd2 T C 15: 12,374,508 E1847G probably damaging Het
Pla2g2f C T 4: 138,754,268 V57I probably benign Het
Prag1 T C 8: 36,146,543 V1083A probably damaging Het
Slc3a2 C T 19: 8,707,955 W227* probably null Het
Snx9 A G 17: 5,920,127 I379M probably benign Het
Tacc2 A G 7: 130,624,065 K846E probably benign Het
Taf4b T A 18: 14,813,098 V326E probably damaging Het
Tnrc6c C T 11: 117,721,922 S462F possibly damaging Het
Trim66 C T 7: 109,455,233 V1257I probably damaging Het
Usp53 A G 3: 122,933,759 L1058P probably benign Het
Wdr24 A G 17: 25,828,238 S702G probably benign Het
Other mutations in Urb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Urb2 APN 8 124028694 missense probably damaging 1.00
IGL00705:Urb2 APN 8 124036637 missense probably benign 0.00
IGL02090:Urb2 APN 8 124028237 missense probably benign 0.28
IGL02707:Urb2 APN 8 124030686 missense probably benign 0.04
IGL03103:Urb2 APN 8 124029752 missense probably benign 0.17
IGL03402:Urb2 APN 8 124029849 missense possibly damaging 0.92
R0037:Urb2 UTSW 8 124047195 missense probably damaging 1.00
R0113:Urb2 UTSW 8 124030926 missense probably benign 0.00
R0883:Urb2 UTSW 8 124030970 nonsense probably null
R1265:Urb2 UTSW 8 124025153 missense probably damaging 1.00
R1463:Urb2 UTSW 8 124030908 missense probably benign 0.04
R1497:Urb2 UTSW 8 124028077 missense probably damaging 1.00
R1556:Urb2 UTSW 8 124030617 missense probably damaging 1.00
R1622:Urb2 UTSW 8 124029624 missense probably benign
R1914:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R1915:Urb2 UTSW 8 124029798 missense possibly damaging 0.81
R2172:Urb2 UTSW 8 124031102 missense probably damaging 1.00
R2240:Urb2 UTSW 8 124030139 missense probably benign 0.02
R2424:Urb2 UTSW 8 124030426 missense probably benign 0.02
R4085:Urb2 UTSW 8 124030941 missense probably benign 0.02
R4119:Urb2 UTSW 8 124047240 missense probably benign 0.00
R4732:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4733:Urb2 UTSW 8 124028897 missense probably damaging 1.00
R4865:Urb2 UTSW 8 124029635 nonsense probably null
R5005:Urb2 UTSW 8 124031181 missense probably damaging 0.97
R5381:Urb2 UTSW 8 124029912 missense probably benign 0.02
R5704:Urb2 UTSW 8 124038182 missense probably damaging 0.97
R5891:Urb2 UTSW 8 124030856 missense possibly damaging 0.64
R5958:Urb2 UTSW 8 124029659 missense probably benign 0.01
R5966:Urb2 UTSW 8 124028088 missense probably benign 0.00
R6133:Urb2 UTSW 8 124028561 nonsense probably null
R6136:Urb2 UTSW 8 124030092 missense probably benign
R6341:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6343:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6344:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6417:Urb2 UTSW 8 124047199 missense probably damaging 1.00
R6420:Urb2 UTSW 8 124047199 missense probably damaging 1.00
R6585:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6586:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6587:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R6588:Urb2 UTSW 8 124031125 missense probably damaging 0.99
R7061:Urb2 UTSW 8 124028297 missense probably benign
R7090:Urb2 UTSW 8 124030599 missense probably benign
R7371:Urb2 UTSW 8 124028269 missense probably benign 0.00
R7467:Urb2 UTSW 8 124028511 missense probably benign
R7542:Urb2 UTSW 8 124028588 missense probably benign
R7545:Urb2 UTSW 8 124029752 missense probably benign 0.00
R7686:Urb2 UTSW 8 124045172 missense probably benign 0.01
R8046:Urb2 UTSW 8 124028032
X0020:Urb2 UTSW 8 124030983 missense possibly damaging 0.91
X0027:Urb2 UTSW 8 124028814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTCTGCCCATCATAAGACGG -3'
(R):5'- ATGTGGCTCACCATGTGCCAAG -3'

Sequencing Primer
(F):5'- TCATAAGACGGACACAGTGC -3'
(R):5'- TGTGAGCAGTGTCAAACCTC -3'
Posted On2014-01-05