Incidental Mutation 'R1126:Olfr473'
ID96166
Institutional Source Beutler Lab
Gene Symbol Olfr473
Ensembl Gene ENSMUSG00000095212
Gene Nameolfactory receptor 473
SynonymsGA_x6K02T2PBJ9-10262759-10263691, MOR204-4
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107930446-107935661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 107934371 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 284 (M284L)
Ref Sequence ENSEMBL: ENSMUSP00000150610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084761] [ENSMUST00000217618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084761
AA Change: M284L

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081816
Gene: ENSMUSG00000095212
AA Change: M284L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.4e-49 PFAM
Pfam:7tm_1 41 290 1.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210626
AA Change: M284L
Predicted Effect possibly damaging
Transcript: ENSMUST00000217618
AA Change: M284L

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Olfr473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Olfr473 APN 7 107934277 nonsense probably null
IGL02361:Olfr473 APN 7 107934277 nonsense probably null
IGL03228:Olfr473 APN 7 107934123 missense possibly damaging 0.94
R0255:Olfr473 UTSW 7 107934168 missense probably damaging 0.96
R0306:Olfr473 UTSW 7 107933700 missense probably damaging 1.00
R1313:Olfr473 UTSW 7 107933768 missense probably benign 0.01
R1313:Olfr473 UTSW 7 107933768 missense probably benign 0.01
R1860:Olfr473 UTSW 7 107934390 missense probably damaging 1.00
R2060:Olfr473 UTSW 7 107933661 missense probably benign 0.00
R2386:Olfr473 UTSW 7 107934273 missense probably damaging 0.99
R4324:Olfr473 UTSW 7 107933693 missense probably damaging 1.00
R4847:Olfr473 UTSW 7 107933827 nonsense probably null
R5926:Olfr473 UTSW 7 107933903 missense probably damaging 0.98
R6964:Olfr473 UTSW 7 107933759 missense probably benign 0.00
R8024:Olfr473 UTSW 7 107934438 missense probably benign 0.00
R8377:Olfr473 UTSW 7 107933685 missense probably damaging 1.00
X0063:Olfr473 UTSW 7 107934345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGAATATGCGCTCCACCGAG -3'
(R):5'- TGCATGATGCAGAGGATCACCAC -3'

Sequencing Primer
(F):5'- CGAGGGTCGCCACAAGG -3'
(R):5'- GAAATCTATCCTGTTTCTCCAAGAG -3'
Posted On2014-01-05