Incidental Mutation 'R1126:Tbx6'
ID96168
Institutional Source Beutler Lab
Gene Symbol Tbx6
Ensembl Gene ENSMUSG00000030699
Gene NameT-box 6
Synonyms
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126781483-126785560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126784719 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 315 (T315I)
Ref Sequence ENSEMBL: ENSMUSP00000126418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032936] [ENSMUST00000038614] [ENSMUST00000094037] [ENSMUST00000106356] [ENSMUST00000106357] [ENSMUST00000145762] [ENSMUST00000170882] [ENSMUST00000172352] [ENSMUST00000205786] [ENSMUST00000205935] [ENSMUST00000206353] [ENSMUST00000206570]
Predicted Effect probably benign
Transcript: ENSMUST00000032936
SMART Domains Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697

DomainStartEndE-ValueType
PP2Ac 20 290 4.04e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038614
SMART Domains Protein: ENSMUSP00000037332
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 6.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094037
AA Change: T314I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699
AA Change: T314I

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 332 348 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106356
SMART Domains Protein: ENSMUSP00000101963
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106357
SMART Domains Protein: ENSMUSP00000101964
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145762
SMART Domains Protein: ENSMUSP00000115596
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 103 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150760
Predicted Effect probably benign
Transcript: ENSMUST00000170882
SMART Domains Protein: ENSMUSP00000128753
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172352
AA Change: T315I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699
AA Change: T315I

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 333 349 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205786
Predicted Effect probably benign
Transcript: ENSMUST00000205935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206143
Predicted Effect probably benign
Transcript: ENSMUST00000206353
Predicted Effect probably benign
Transcript: ENSMUST00000206477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206261
Predicted Effect probably benign
Transcript: ENSMUST00000206334
Predicted Effect probably benign
Transcript: ENSMUST00000206570
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Knockout studies in mice indicate that this gene is important for specification of paraxial mesoderm structures. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis exhibiting defects in paraxial mesoderm differentiation, ectopic neural tube development, kinked neural tubes, impaired somite development, hematomas, enlarged tail buds, and laterality defects associated with nodal cilium anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Tbx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tbx6 APN 7 126781529 missense probably damaging 1.00
IGL01899:Tbx6 APN 7 126784532 unclassified probably benign
R1018:Tbx6 UTSW 7 126783192 unclassified probably benign
R2045:Tbx6 UTSW 7 126782883 missense probably damaging 1.00
R4913:Tbx6 UTSW 7 126784535 critical splice acceptor site probably null
R5251:Tbx6 UTSW 7 126783344 missense probably damaging 1.00
R5926:Tbx6 UTSW 7 126784853 missense possibly damaging 0.53
R5927:Tbx6 UTSW 7 126784853 missense possibly damaging 0.53
R6285:Tbx6 UTSW 7 126781568 missense possibly damaging 0.57
R7072:Tbx6 UTSW 7 126784740 missense probably benign 0.37
R8023:Tbx6 UTSW 7 126782859 missense possibly damaging 0.88
R8544:Tbx6 UTSW 7 126781484 splice site probably null
Predicted Primers PCR Primer
(F):5'- TACAAGTCTGAGAGGAACCTCCGC -3'
(R):5'- TGGTACAGATGGAGCTGCCTGATAG -3'

Sequencing Primer
(F):5'- catcatcatcacatcatcatcgtc -3'
(R):5'- CTGTAGGTCCAGAAATGCAGC -3'
Posted On2014-01-05