Incidental Mutation 'R1126:Gas6'
ID96170
Institutional Source Beutler Lab
Gene Symbol Gas6
Ensembl Gene ENSMUSG00000031451
Gene Namegrowth arrest specific 6
Synonymsgrowth arrest-specific, Gas-6, GAS 6
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13465374-13494490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13483700 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 103 (N103S)
Ref Sequence ENSEMBL: ENSMUSP00000033828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033828]
Predicted Effect probably benign
Transcript: ENSMUST00000033828
AA Change: N103S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000033828
Gene: ENSMUSG00000031451
AA Change: N103S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
GLA 26 90 6.66e-30 SMART
EGF 116 151 3.97e0 SMART
EGF_CA 153 193 3.1e-11 SMART
EGF_CA 194 234 1.91e-11 SMART
EGF_CA 235 275 1.25e-6 SMART
LamG 314 450 2.71e-24 SMART
LamG 502 647 1.27e-15 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-carboxyglutamic acid (Gla)-containing protein thought to be involved in the stimulation of cell proliferation. This gene is frequently overexpressed in many cancers and has been implicated as an adverse prognostic marker. Elevated protein levels are additionally associated with a variety of disease states, including venous thromboembolic disease, systemic lupus erythematosus, chronic renal failure, and preeclampsia. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice are protected against arterial and venous thrombosis, and though platelet aggregation is impaired, spontaneous or excess trauma-induced bleeding is not observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Gas6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Gas6 APN 8 13476171 missense probably damaging 0.99
IGL01100:Gas6 APN 8 13475118 missense probably benign 0.27
IGL02014:Gas6 APN 8 13468359 missense possibly damaging 0.59
IGL02931:Gas6 APN 8 13477136 missense probably damaging 0.98
R0023:Gas6 UTSW 8 13470344 missense probably damaging 1.00
R0497:Gas6 UTSW 8 13470387 missense possibly damaging 0.86
R1597:Gas6 UTSW 8 13493901 missense probably damaging 1.00
R1601:Gas6 UTSW 8 13465786 missense probably damaging 1.00
R1643:Gas6 UTSW 8 13465902 critical splice acceptor site probably null
R1914:Gas6 UTSW 8 13477152 missense probably benign
R1967:Gas6 UTSW 8 13470317 missense probably damaging 0.98
R2012:Gas6 UTSW 8 13468266 missense probably damaging 1.00
R4663:Gas6 UTSW 8 13470254 missense probably damaging 1.00
R4723:Gas6 UTSW 8 13466848 missense probably damaging 0.99
R4750:Gas6 UTSW 8 13476227 missense probably benign 0.29
R4869:Gas6 UTSW 8 13475086 missense possibly damaging 0.55
R5558:Gas6 UTSW 8 13466764 missense probably null 0.03
R5706:Gas6 UTSW 8 13477098 missense probably damaging 0.98
R5791:Gas6 UTSW 8 13470217 critical splice donor site probably null
R6767:Gas6 UTSW 8 13465784 missense probably damaging 0.98
R6825:Gas6 UTSW 8 13483674 missense probably benign 0.00
R7374:Gas6 UTSW 8 13474802 missense probably damaging 0.99
R7419:Gas6 UTSW 8 13471456 missense probably benign 0.19
R7588:Gas6 UTSW 8 13466711 missense probably benign 0.03
R7810:Gas6 UTSW 8 13466809 missense probably damaging 1.00
X0063:Gas6 UTSW 8 13471538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCAAAAGCCATGTCTGCATTTC -3'
(R):5'- GTTCGGTCACACTGGTACACCTTC -3'

Sequencing Primer
(F):5'- CTGAAAGAGGGTTTTGCCCAC -3'
(R):5'- ACTGGTACACCTTCCTGCTG -3'
Posted On2014-01-05