Incidental Mutation 'R1126:Tcf12'
ID96175
Institutional Source Beutler Lab
Gene Symbol Tcf12
Ensembl Gene ENSMUSG00000032228
Gene Nametranscription factor 12
SynonymsHTF-4, ALF1, HEB, bHLHb20, HEBAlt, REB, HTF4, ME1
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location71842688-72111871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72000433 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 99 (M99T)
Ref Sequence ENSEMBL: ENSMUSP00000138832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034755] [ENSMUST00000183404] [ENSMUST00000183492] [ENSMUST00000183594] [ENSMUST00000183992] [ENSMUST00000184072] [ENSMUST00000184107] [ENSMUST00000184416] [ENSMUST00000184523] [ENSMUST00000184783] [ENSMUST00000184867] [ENSMUST00000185117]
Predicted Effect probably benign
Transcript: ENSMUST00000034755
AA Change: M103T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034755
Gene: ENSMUSG00000032228
AA Change: M103T

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183404
AA Change: M103T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139365
Gene: ENSMUSG00000032228
AA Change: M103T

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183492
SMART Domains Protein: ENSMUSP00000138939
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183594
Predicted Effect unknown
Transcript: ENSMUST00000183647
AA Change: M14T
Predicted Effect probably benign
Transcript: ENSMUST00000183992
AA Change: M103T

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139084
Gene: ENSMUSG00000032228
AA Change: M103T

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 5e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184072
SMART Domains Protein: ENSMUSP00000139284
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
PDB:4JOL|H 85 108 4e-8 PDB
low complexity region 116 127 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184196
Predicted Effect unknown
Transcript: ENSMUST00000184416
AA Change: M15T
Predicted Effect probably benign
Transcript: ENSMUST00000184523
AA Change: M99T

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138832
Gene: ENSMUSG00000032228
AA Change: M99T

DomainStartEndE-ValueType
PDB:4JOL|H 173 196 6e-8 PDB
low complexity region 204 215 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 348 359 N/A INTRINSIC
low complexity region 554 568 N/A INTRINSIC
HLH 603 656 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184783
AA Change: M103T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139364
Gene: ENSMUSG00000032228
AA Change: M103T

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184867
Predicted Effect probably benign
Transcript: ENSMUST00000185117
AA Change: M103T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138925
Gene: ENSMUSG00000032228
AA Change: M103T

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 534 548 N/A INTRINSIC
HLH 583 636 7.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192895
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Tcf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Tcf12 APN 9 71868118 missense probably damaging 0.98
IGL01311:Tcf12 APN 9 71858656 splice site probably benign
IGL01734:Tcf12 APN 9 71922648 splice site probably null
IGL01768:Tcf12 APN 9 71868996 splice site probably null
IGL02625:Tcf12 APN 9 71922757 missense probably damaging 1.00
IGL02671:Tcf12 APN 9 72109717 missense probably damaging 1.00
IGL03395:Tcf12 APN 9 71876022 missense probably damaging 1.00
Beneath UTSW 9 71883103 splice site probably null
Poorly UTSW 9 71944016 nonsense probably null
Poorly2 UTSW 9 71858929 missense probably damaging 1.00
Poorly3 UTSW 9 72015636 critical splice donor site probably null
Substandard UTSW 9 71858840 missense probably null 0.54
R0183:Tcf12 UTSW 9 71917027 missense probably damaging 0.99
R0257:Tcf12 UTSW 9 71858622 missense probably benign 0.05
R1520:Tcf12 UTSW 9 71883106 critical splice donor site probably null
R1690:Tcf12 UTSW 9 71870072 critical splice donor site probably null
R1819:Tcf12 UTSW 9 72109717 missense probably damaging 1.00
R1850:Tcf12 UTSW 9 71868215 missense probably damaging 1.00
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R2402:Tcf12 UTSW 9 71856510 missense probably damaging 1.00
R4445:Tcf12 UTSW 9 71869063 missense probably damaging 0.99
R4693:Tcf12 UTSW 9 71868967 intron probably benign
R4814:Tcf12 UTSW 9 71870041 intron probably benign
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4885:Tcf12 UTSW 9 71858840 missense probably null 0.54
R5347:Tcf12 UTSW 9 71885243 missense probably damaging 1.00
R5422:Tcf12 UTSW 9 71869038 missense probably damaging 1.00
R5650:Tcf12 UTSW 9 71885302 splice site probably null
R5713:Tcf12 UTSW 9 71885263 makesense probably null
R5789:Tcf12 UTSW 9 71885236 missense probably damaging 1.00
R5964:Tcf12 UTSW 9 71868240 missense probably damaging 1.00
R6012:Tcf12 UTSW 9 71858947 missense possibly damaging 0.62
R6119:Tcf12 UTSW 9 71868265 missense probably damaging 1.00
R6240:Tcf12 UTSW 9 71944016 nonsense probably null
R6299:Tcf12 UTSW 9 71858929 missense probably damaging 1.00
R6449:Tcf12 UTSW 9 71868268 missense probably damaging 1.00
R6489:Tcf12 UTSW 9 72015636 critical splice donor site probably null
R6984:Tcf12 UTSW 9 72006759 nonsense probably null
R7146:Tcf12 UTSW 9 71883103 splice site probably null
R7734:Tcf12 UTSW 9 71922661 missense probably benign 0.00
R7955:Tcf12 UTSW 9 71870070 splice site probably null
X0021:Tcf12 UTSW 9 71883172 missense probably damaging 0.99
X0022:Tcf12 UTSW 9 72109743 missense probably damaging 0.99
Z1177:Tcf12 UTSW 9 72000460 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CGGTGAGAGGTCTAACCCTTCAAAC -3'
(R):5'- AGCCTGTGCATTCATAAGGTGCTAC -3'

Sequencing Primer
(F):5'- TCTGGCTCAGAGAACTTGC -3'
(R):5'- ATAAGGTGCTACTGTACACTCC -3'
Posted On2014-01-05