Incidental Mutation 'R1126:Il6st'
ID96193
Institutional Source Beutler Lab
Gene Symbol Il6st
Ensembl Gene ENSMUSG00000021756
Gene Nameinterleukin 6 signal transducer
SynonymsD13Ertd699e, gp130, CD130, 5133400A03Rik
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112464070-112510086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112503732 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 681 (Y681H)
Ref Sequence ENSEMBL: ENSMUSP00000139227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070731] [ENSMUST00000183513] [ENSMUST00000183663] [ENSMUST00000183829] [ENSMUST00000184276] [ENSMUST00000184311] [ENSMUST00000184445] [ENSMUST00000184949]
Predicted Effect probably damaging
Transcript: ENSMUST00000070731
AA Change: Y681H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064205
Gene: ENSMUSG00000021756
AA Change: Y681H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 26 112 1.4e-30 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000183513
SMART Domains Protein: ENSMUSP00000139016
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183663
AA Change: Y681H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138836
Gene: ENSMUSG00000021756
AA Change: Y681H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000183829
SMART Domains Protein: ENSMUSP00000138987
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:1I1R|A 23 52 7e-8 PDB
FN3 56 142 7.23e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184276
SMART Domains Protein: ENSMUSP00000139060
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2.3e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184311
AA Change: Y681H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139227
Gene: ENSMUSG00000021756
AA Change: Y681H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 1.2e-32 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 407 1.07e1 SMART
FN3 422 503 6.1e0 SMART
FN3 517 600 4.81e-4 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 718 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184445
SMART Domains Protein: ENSMUSP00000139311
Gene: ENSMUSG00000021756

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 2e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184949
AA Change: Y620H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138915
Gene: ENSMUSG00000021756
AA Change: Y620H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Lep_receptor_Ig 24 114 9.4e-33 PFAM
FN3 126 205 1.15e1 SMART
FN3 220 306 7.23e-8 SMART
FN3 324 442 6.97e0 SMART
FN3 456 539 4.81e-4 SMART
transmembrane domain 557 579 N/A INTRINSIC
low complexity region 657 692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations show myocardial and hematological defects and die between embryonic day 12.5 and term. Conditional mutants show female infertility and neurological, cardiac, hematopoietic, immunological, hepatic, and lung defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Il6st
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Il6st APN 13 112481433 unclassified probably null
IGL00571:Il6st APN 13 112487860 missense probably damaging 1.00
IGL01151:Il6st APN 13 112493651 missense probably benign 0.00
IGL01336:Il6st APN 13 112480239 missense possibly damaging 0.71
IGL01501:Il6st APN 13 112480059 missense probably benign 0.22
IGL01512:Il6st APN 13 112504366 missense probably benign 0.36
IGL01657:Il6st APN 13 112481543 missense probably damaging 1.00
IGL01863:Il6st APN 13 112504210 missense possibly damaging 0.88
IGL01916:Il6st APN 13 112480072 missense possibly damaging 0.90
IGL01978:Il6st APN 13 112497357 missense possibly damaging 0.51
IGL02089:Il6st APN 13 112495240 missense probably benign 0.12
IGL02752:Il6st APN 13 112480195 missense probably damaging 0.98
IGL02988:Il6st UTSW 13 112498886 missense probably damaging 1.00
R0019:Il6st UTSW 13 112501148 missense possibly damaging 0.94
R0550:Il6st UTSW 13 112475114 splice site probably null
R0606:Il6st UTSW 13 112504272 missense possibly damaging 0.78
R1452:Il6st UTSW 13 112481464 missense possibly damaging 0.79
R1581:Il6st UTSW 13 112481541 missense probably damaging 0.99
R1632:Il6st UTSW 13 112504332 missense possibly damaging 0.86
R1881:Il6st UTSW 13 112504413 missense probably damaging 1.00
R2013:Il6st UTSW 13 112498889 missense probably null 0.94
R2043:Il6st UTSW 13 112480219 missense probably benign 0.00
R2128:Il6st UTSW 13 112504175 missense probably benign 0.01
R2137:Il6st UTSW 13 112502858 missense possibly damaging 0.92
R3433:Il6st UTSW 13 112503831 missense probably damaging 1.00
R3696:Il6st UTSW 13 112504382 missense probably benign 0.13
R3697:Il6st UTSW 13 112504382 missense probably benign 0.13
R3698:Il6st UTSW 13 112504382 missense probably benign 0.13
R4172:Il6st UTSW 13 112495327 missense probably benign 0.25
R4543:Il6st UTSW 13 112481459 missense probably damaging 1.00
R4641:Il6st UTSW 13 112488530 missense probably damaging 1.00
R4838:Il6st UTSW 13 112490510 nonsense probably null
R4899:Il6st UTSW 13 112501161 missense probably damaging 1.00
R4922:Il6st UTSW 13 112502865 missense probably damaging 0.98
R5088:Il6st UTSW 13 112490555 missense probably damaging 1.00
R5104:Il6st UTSW 13 112488648 missense probably benign 0.02
R5853:Il6st UTSW 13 112481537 missense probably damaging 1.00
R6602:Il6st UTSW 13 112504413 missense probably damaging 1.00
R7082:Il6st UTSW 13 112504032 missense probably damaging 1.00
R7101:Il6st UTSW 13 112495373 critical splice donor site probably null
R7192:Il6st UTSW 13 112495207 missense probably benign 0.00
R7273:Il6st UTSW 13 112495298 missense probably benign 0.37
R7330:Il6st UTSW 13 112493651 missense probably benign 0.00
R7427:Il6st UTSW 13 112488560 missense probably benign 0.01
R7770:Il6st UTSW 13 112502804 missense probably damaging 1.00
U24488:Il6st UTSW 13 112494634 missense possibly damaging 0.90
Z1176:Il6st UTSW 13 112493618 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGCAGCCCGATCCAGACTTC -3'
(R):5'- GTGCTCTGAGCAGACTCATTCTCC -3'

Sequencing Primer
(F):5'- GCAGTTCATCTGGTTACAGAGAC -3'
(R):5'- CCTCGTTGCTGGAGATGC -3'
Posted On2014-01-05