Incidental Mutation 'R1126:Slc39a2'
ID96203
Institutional Source Beutler Lab
Gene Symbol Slc39a2
Ensembl Gene ENSMUSG00000072572
Gene Namesolute carrier family 39 (zinc transporter), member 2
Synonymszip2, F730005G13Rik
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51892889-51896745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 51894145 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 58 (G58R)
Ref Sequence ENSEMBL: ENSMUSP00000038707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047726] [ENSMUST00000047899] [ENSMUST00000161888] [ENSMUST00000164252] [ENSMUST00000164902] [ENSMUST00000165100] [ENSMUST00000165568] [ENSMUST00000168217]
Predicted Effect probably damaging
Transcript: ENSMUST00000047726
AA Change: G58R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038707
Gene: ENSMUSG00000072572
AA Change: G58R

DomainStartEndE-ValueType
Pfam:Zip 5 306 1.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047899
SMART Domains Protein: ENSMUSP00000047720
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 442 8e-65 PFAM
Pfam:Methyltransf_11 191 293 5.9e-7 PFAM
low complexity region 446 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160668
Predicted Effect probably damaging
Transcript: ENSMUST00000161888
AA Change: G58R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124399
Gene: ENSMUSG00000072572
AA Change: G58R

DomainStartEndE-ValueType
Pfam:Zip 5 163 8.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163603
Predicted Effect probably benign
Transcript: ENSMUST00000164252
SMART Domains Protein: ENSMUSP00000130038
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164902
SMART Domains Protein: ENSMUSP00000130200
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 467 1.7e-61 PFAM
Pfam:Methyltransf_11 191 294 3.6e-6 PFAM
low complexity region 471 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165100
SMART Domains Protein: ENSMUSP00000132354
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Pfam:Rsm22 153 235 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165568
SMART Domains Protein: ENSMUSP00000129973
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
Pfam:Rsm22 100 269 1.5e-37 PFAM
Pfam:Methyltransf_11 138 240 2.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166408
Predicted Effect probably benign
Transcript: ENSMUST00000168217
SMART Domains Protein: ENSMUSP00000130565
Gene: ENSMUSG00000004561

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 63 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169019
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIP family of metal ion transporters. The encoded protein functions as a zinc transporter. Mutations in this gene may be associated with susceptibility to carotid artery disease. Multiple transcript variants have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a null allele are overtly normal when fed a zinc-replete diet but show increased sensitivity to the effects of maternal dietary zinc deficiency during pregnancy. Resulting embryos are often growth retarded with craniofacial and limb defects, and show altered iron and calcium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Slc39a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Slc39a2 APN 14 51895136 nonsense probably null
IGL02421:Slc39a2 APN 14 51893872 missense probably benign 0.00
IGL02546:Slc39a2 APN 14 51895163 missense probably benign 0.16
IGL02823:Slc39a2 APN 14 51895412 missense probably damaging 1.00
R4923:Slc39a2 UTSW 14 51895254 missense probably damaging 1.00
R5106:Slc39a2 UTSW 14 51895531 makesense probably null
R6158:Slc39a2 UTSW 14 51894224 unclassified probably null
R7094:Slc39a2 UTSW 14 51893689 unclassified probably benign
R7324:Slc39a2 UTSW 14 51894193 missense possibly damaging 0.74
R7340:Slc39a2 UTSW 14 51894203 missense possibly damaging 0.87
R7578:Slc39a2 UTSW 14 51895416 missense probably damaging 1.00
R7599:Slc39a2 UTSW 14 51895031 missense probably benign 0.10
Z1177:Slc39a2 UTSW 14 51893895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCCAGATGGATGCAGCTACAG -3'
(R):5'- AAGCTTTCCTCAGATGCTCAACCC -3'

Sequencing Primer
(F):5'- TGCAGCTACAGGTACAGCC -3'
(R):5'- ACGTCTACTCAACAGCGG -3'
Posted On2014-01-05