Incidental Mutation 'R1126:Tdrd3'
ID96209
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Nametudor domain containing 3
Synonyms4732418C03Rik
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location87416639-87545504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87480774 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 197 (D197G)
Ref Sequence ENSEMBL: ENSMUSP00000126189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163714] [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163714
SMART Domains Protein: ENSMUSP00000128074
Gene: ENSMUSG00000022019

DomainStartEndE-ValueType
PDB:3NBI|A 1 74 2e-10 PDB
low complexity region 176 187 N/A INTRINSIC
UBA 195 232 1.67e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168275
AA Change: D203G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019
AA Change: D203G

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169504
AA Change: D203G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019
AA Change: D203G

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000170712
AA Change: D191G
SMART Domains Protein: ENSMUSP00000126212
Gene: ENSMUSG00000022019
AA Change: D191G

DomainStartEndE-ValueType
DUF1767 19 77 4.37e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170865
AA Change: D197G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019
AA Change: D197G

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87472182 missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87480794 missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87472232 missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87511682 missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87539479 missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87486220 missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87472182 missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87506398 missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87487239 missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87458054 intron probably benign
R1592:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87486347 splice site probably null
R2096:Tdrd3 UTSW 14 87506352 nonsense probably null
R2162:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3947:Tdrd3 UTSW 14 87506599 missense probably damaging 1.00
R4421:Tdrd3 UTSW 14 87486283 missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87472101 missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87505787 missense probably benign 0.06
R5212:Tdrd3 UTSW 14 87506215 missense probably damaging 0.98
R5291:Tdrd3 UTSW 14 87505798 missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87477463 critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87480791 nonsense probably null
R5718:Tdrd3 UTSW 14 87506440 missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87506254 missense probably benign
R6532:Tdrd3 UTSW 14 87505816 missense probably damaging 0.98
R6850:Tdrd3 UTSW 14 87458079 intron probably benign
R6958:Tdrd3 UTSW 14 87457096 missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87477403 missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87458803 missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87506593 nonsense probably null
R7818:Tdrd3 UTSW 14 87472200 missense probably damaging 1.00
R7861:Tdrd3 UTSW 14 87472154 missense probably damaging 1.00
R8108:Tdrd3 UTSW 14 87486266 missense possibly damaging 0.95
R8206:Tdrd3 UTSW 14 87511778 missense probably benign 0.11
R8383:Tdrd3 UTSW 14 87506308 missense probably benign 0.26
R8786:Tdrd3 UTSW 14 87472201 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTAGAATGAAACTTGGGTCTTGC -3'
(R):5'- AGGAATTGGCCTCCTCTGCTTGTC -3'

Sequencing Primer
(F):5'- AAACTTGGGTCTTGCAGTCC -3'
(R):5'- TATGTGAGCAGCAGTGATGACC -3'
Posted On2014-01-05