Incidental Mutation 'R1126:Ephb3'
ID96221
Institutional Source Beutler Lab
Gene Symbol Ephb3
Ensembl Gene ENSMUSG00000005958
Gene NameEph receptor B3
SynonymsTyro6, HEK2, MDK5, Sek4, Etk2, Cek10
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location21204755-21223305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21222476 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 727 (M727K)
Ref Sequence ENSEMBL: ENSMUSP00000124375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006112] [ENSMUST00000161063]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006112
AA Change: M981K

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006112
Gene: ENSMUSG00000005958
AA Change: M981K

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
EPH_lbd 31 204 6.47e-126 SMART
Pfam:GCC2_GCC3 269 312 5.8e-9 PFAM
FN3 332 430 8.43e-9 SMART
FN3 448 527 2.72e-12 SMART
Pfam:EphA2_TM 555 625 1e-24 PFAM
TyrKc 628 887 1.35e-134 SMART
SAM 917 984 3.88e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160053
Predicted Effect possibly damaging
Transcript: ENSMUST00000161063
AA Change: M727K

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in corpus callosum formation and impaired Paneth cell downward migration in the intestinal epithelium, resulting in scattered positioning along crypt and villus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr137 A G 17: 38,304,688 C258R probably damaging Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Ephb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ephb3 APN 16 21220415 splice site probably null
IGL00966:Ephb3 APN 16 21217294 missense probably benign 0.00
IGL02166:Ephb3 APN 16 21220749 missense probably damaging 1.00
IGL02245:Ephb3 APN 16 21221424 missense probably benign 0.04
IGL02321:Ephb3 APN 16 21214389 missense probably damaging 1.00
IGL02337:Ephb3 APN 16 21221503 splice site probably null
IGL02507:Ephb3 APN 16 21220639 splice site probably benign
IGL02755:Ephb3 APN 16 21221698 missense probably damaging 1.00
IGL02806:Ephb3 APN 16 21222281 missense probably benign 0.02
PIT4362001:Ephb3 UTSW 16 21220857 missense probably damaging 1.00
R0026:Ephb3 UTSW 16 21214917 missense probably damaging 1.00
R0194:Ephb3 UTSW 16 21218109 missense probably benign 0.01
R0196:Ephb3 UTSW 16 21218054 missense probably damaging 1.00
R0230:Ephb3 UTSW 16 21220775 missense probably damaging 1.00
R0828:Ephb3 UTSW 16 21219034 unclassified probably benign
R1460:Ephb3 UTSW 16 21218922 missense probably benign
R1592:Ephb3 UTSW 16 21221700 missense probably damaging 1.00
R1632:Ephb3 UTSW 16 21212937 missense probably benign 0.00
R1694:Ephb3 UTSW 16 21221745 missense probably damaging 1.00
R1719:Ephb3 UTSW 16 21220650 missense probably damaging 1.00
R1777:Ephb3 UTSW 16 21217235 missense probably damaging 0.99
R1928:Ephb3 UTSW 16 21222295 missense possibly damaging 0.86
R1956:Ephb3 UTSW 16 21221382 missense probably damaging 1.00
R2378:Ephb3 UTSW 16 21218243 missense probably benign
R3408:Ephb3 UTSW 16 21219504 missense probably damaging 0.99
R4027:Ephb3 UTSW 16 21221697 missense probably damaging 1.00
R4429:Ephb3 UTSW 16 21214463 missense probably damaging 1.00
R4655:Ephb3 UTSW 16 21222208 missense probably damaging 0.98
R4826:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4828:Ephb3 UTSW 16 21214995 missense possibly damaging 0.90
R4960:Ephb3 UTSW 16 21220495 missense probably benign 0.09
R5057:Ephb3 UTSW 16 21220447 missense probably damaging 1.00
R5090:Ephb3 UTSW 16 21214487 missense probably damaging 1.00
R5396:Ephb3 UTSW 16 21219105 missense possibly damaging 0.91
R5540:Ephb3 UTSW 16 21220860 missense probably damaging 1.00
R5628:Ephb3 UTSW 16 21218119 missense probably damaging 1.00
R5666:Ephb3 UTSW 16 21222491 missense probably benign 0.08
R5838:Ephb3 UTSW 16 21221687 missense probably damaging 1.00
R5866:Ephb3 UTSW 16 21211379 intron probably benign
R6017:Ephb3 UTSW 16 21222031 missense probably damaging 1.00
R6020:Ephb3 UTSW 16 21222013 missense probably damaging 0.99
R6510:Ephb3 UTSW 16 21218111 missense probably damaging 0.98
R6539:Ephb3 UTSW 16 21221468 missense probably benign
R6591:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R6691:Ephb3 UTSW 16 21214473 missense probably damaging 1.00
R7101:Ephb3 UTSW 16 21218518 missense possibly damaging 0.86
R7111:Ephb3 UTSW 16 21218827 nonsense probably null
R7236:Ephb3 UTSW 16 21214481 missense probably damaging 1.00
R7307:Ephb3 UTSW 16 21222226 missense probably benign 0.04
R7410:Ephb3 UTSW 16 21221408 missense possibly damaging 0.75
R7413:Ephb3 UTSW 16 21214707 missense probably damaging 1.00
R7452:Ephb3 UTSW 16 21217357 splice site probably null
R7944:Ephb3 UTSW 16 21221684 missense probably damaging 1.00
R7945:Ephb3 UTSW 16 21221684 missense probably damaging 1.00
Z1176:Ephb3 UTSW 16 21218036 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCAGAGTAAGTGTACCGCTCAAGG -3'
(R):5'- GCCCAATCTGAGTTGTGAAGACTCC -3'

Sequencing Primer
(F):5'- TGTACCGCTCAAGGTGCAG -3'
(R):5'- AGTTGTGAAGACTCCCCACTG -3'
Posted On2014-01-05