Incidental Mutation 'R1126:Olfr137'
ID96233
Institutional Source Beutler Lab
Gene Symbol Olfr137
Ensembl Gene ENSMUSG00000054940
Gene Nameolfactory receptor 137
SynonymsMOR256-18, GA_x6K02T2PSCP-2749525-2748587
MMRRC Submission 039199-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1126 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38303527-38307570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38304688 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 258 (C258R)
Ref Sequence ENSEMBL: ENSMUSP00000150173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057394] [ENSMUST00000213505]
Predicted Effect probably damaging
Transcript: ENSMUST00000057394
AA Change: C258R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051537
Gene: ENSMUSG00000054940
AA Change: C258R

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4e-49 PFAM
Pfam:7tm_1 42 291 4.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213505
AA Change: C258R

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,109,638 E1226G probably damaging Het
Arhgef40 G T 14: 51,997,126 S962I probably damaging Het
Atp9b A T 18: 80,778,954 M477K probably damaging Het
Enpp2 C T 15: 54,906,826 probably null Het
Ephb3 T A 16: 21,222,476 M727K possibly damaging Het
Exo5 A T 4: 120,922,125 I181N probably damaging Het
Fbn1 T C 2: 125,321,192 probably null Het
Gas6 T C 8: 13,483,700 N103S probably benign Het
Gm11596 A T 11: 99,792,873 C140* probably null Het
Il6st T C 13: 112,503,732 Y681H probably damaging Het
Itih4 T C 14: 30,889,961 probably null Het
Kdm5b C T 1: 134,613,991 A768V possibly damaging Het
Krt83 A T 15: 101,487,482 N336K probably damaging Het
Mfsd6 A G 1: 52,709,511 V65A probably benign Het
Nipsnap1 A G 11: 4,884,081 N90S probably benign Het
Nlrp9a C A 7: 26,560,741 D640E probably benign Het
Olfr365 A T 2: 37,202,101 M287L probably benign Het
Olfr473 A C 7: 107,934,371 M284L possibly damaging Het
Olfr747 C T 14: 50,681,263 A124T possibly damaging Het
Parp9 G A 16: 35,947,740 V97I possibly damaging Het
Pdzd2 T C 15: 12,458,220 T12A possibly damaging Het
Penk T C 4: 4,138,119 T9A probably benign Het
Pilrb2 T C 5: 137,870,960 D126G probably damaging Het
Pkdrej A T 15: 85,816,314 V1807E probably damaging Het
Ppp1r9a A G 6: 4,906,795 E450G possibly damaging Het
Rag1 T C 2: 101,642,689 R703G probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rmdn3 T C 2: 119,153,995 D92G probably benign Het
Rp1l1 G A 14: 64,030,469 G1168D probably damaging Het
Saxo1 T A 4: 86,478,987 T105S probably benign Het
Slc39a2 G A 14: 51,894,145 G58R probably damaging Het
Tbx6 C T 7: 126,784,719 T315I probably damaging Het
Tcf12 A G 9: 72,000,433 M99T probably benign Het
Tdrd3 A G 14: 87,480,774 D197G probably damaging Het
Tnc T C 4: 64,018,120 N193S probably damaging Het
Ttn A G 2: 76,850,003 probably benign Het
Vmn1r225 A G 17: 20,502,326 I10V probably benign Het
Zp3r A G 1: 130,618,342 L77P probably damaging Het
Other mutations in Olfr137
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Olfr137 APN 17 38304648 missense probably benign 0.03
IGL03169:Olfr137 APN 17 38305101 missense probably damaging 1.00
IGL03392:Olfr137 APN 17 38304895 missense probably benign 0.02
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0496:Olfr137 UTSW 17 38304658 missense probably damaging 0.99
R0761:Olfr137 UTSW 17 38305391 missense probably benign 0.00
R1835:Olfr137 UTSW 17 38305312 missense probably benign 0.02
R3727:Olfr137 UTSW 17 38305419 missense possibly damaging 0.64
R5556:Olfr137 UTSW 17 38305073 missense possibly damaging 0.71
R5979:Olfr137 UTSW 17 38305192 missense probably benign
R6430:Olfr137 UTSW 17 38305358 missense probably benign 0.04
R6433:Olfr137 UTSW 17 38305413 missense probably damaging 1.00
R7400:Olfr137 UTSW 17 38305331 missense possibly damaging 0.91
R8053:Olfr137 UTSW 17 38305210 missense probably benign
R8199:Olfr137 UTSW 17 38304553 missense probably benign 0.31
R8446:Olfr137 UTSW 17 38304747 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACTGCACAGTGGGAGGCTTATC -3'
(R):5'- CAGCATCCTGGGTATGTGGCTTTAC -3'

Sequencing Primer
(F):5'- ACAGTGGGAGGCTTATCTCATTTC -3'
(R):5'- GCAAAGTAGACCACTTCTTCTGTG -3'
Posted On2014-01-05