Incidental Mutation 'R1015:Mcc'
ID96234
Institutional Source Beutler Lab
Gene Symbol Mcc
Ensembl Gene ENSMUSG00000071856
Gene Namemutated in colorectal cancers
SynonymsD18Ertd451e
MMRRC Submission 039119-MU
Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1015 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location44425060-44812182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44724669 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 126 (L126F)
Ref Sequence ENSEMBL: ENSMUSP00000087318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089874]
Predicted Effect probably benign
Transcript: ENSMUST00000089874
AA Change: L126F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856
AA Change: L126F

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
EFh 24 52 1.36e-3 SMART
EFh 57 85 7.36e0 SMART
coiled coil region 196 308 N/A INTRINSIC
coiled coil region 395 466 N/A INTRINSIC
low complexity region 488 493 N/A INTRINSIC
low complexity region 512 517 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 577 641 2.6e-32 PFAM
low complexity region 715 731 N/A INTRINSIC
coiled coil region 738 834 N/A INTRINSIC
low complexity region 853 863 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 906 972 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201270
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3d1 A G 10: 80,716,489 V615A probably damaging Het
Atp6v1d A G 12: 78,849,769 V108A possibly damaging Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt6 C A 7: 98,194,595 V53L probably benign Het
C8b A G 4: 104,786,960 K275E probably benign Het
Cage1 T A 13: 38,016,475 N683I possibly damaging Het
Celsr3 T C 9: 108,833,176 V1535A probably benign Het
Cep120 C T 18: 53,703,121 probably null Het
Cep135 T C 5: 76,640,997 probably null Het
Chd9 T A 8: 90,932,578 H55Q probably damaging Het
Dmxl2 G A 9: 54,367,765 T2915I probably benign Het
Eps8l1 A T 7: 4,469,933 D118V probably damaging Het
Galnt2 C T 8: 124,336,617 H359Y probably benign Het
Gm8765 T G 13: 50,701,628 V434G possibly damaging Het
Gm884 T C 11: 103,545,796 H754R probably benign Het
Kdm5d T C Y: 941,687 V1296A possibly damaging Het
Kif27 T A 13: 58,320,215 K849N probably damaging Het
Kif5c T A 2: 49,744,365 D736E probably benign Het
Krt18 T C 15: 102,031,300 I311T probably benign Het
Lamc2 A T 1: 153,166,199 V63D possibly damaging Het
Lmbrd1 T A 1: 24,731,878 C295* probably null Het
Map3k14 T A 11: 103,225,300 Q767H probably damaging Het
Mapkapk5 T C 5: 121,533,362 K203E probably benign Het
Mib1 T A 18: 10,726,409 H35Q probably damaging Het
Myo16 A G 8: 10,390,183 N412D probably benign Het
Ndst2 T C 14: 20,730,064 Y36C probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nwd2 T C 5: 63,806,811 I1246T probably damaging Het
Olfr1034 T C 2: 86,047,082 I200T possibly damaging Het
Olfr74 T C 2: 87,974,087 T193A probably benign Het
Patl1 T C 19: 11,920,373 V108A probably benign Het
Pdzd2 T C 15: 12,374,508 E1847G probably damaging Het
Pla2g2f C T 4: 138,754,268 V57I probably benign Het
Prag1 T C 8: 36,146,543 V1083A probably damaging Het
Slc3a2 C T 19: 8,707,955 W227* probably null Het
Snx9 A G 17: 5,920,127 I379M probably benign Het
Tacc2 A G 7: 130,624,065 K846E probably benign Het
Taf4b T A 18: 14,813,098 V326E probably damaging Het
Tnrc6c C T 11: 117,721,922 S462F possibly damaging Het
Trim66 C T 7: 109,455,233 V1257I probably damaging Het
Urb2 T C 8: 124,029,434 Y627H probably damaging Het
Usp53 A G 3: 122,933,759 L1058P probably benign Het
Wdr24 A G 17: 25,828,238 S702G probably benign Het
Other mutations in Mcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Mcc APN 18 44449216 missense possibly damaging 0.93
IGL00981:Mcc APN 18 44449349 missense probably damaging 0.99
IGL00985:Mcc APN 18 44491239 missense probably damaging 1.00
IGL01674:Mcc APN 18 44491156 missense probably benign 0.10
IGL01862:Mcc APN 18 44759296 missense probably benign 0.00
IGL01935:Mcc APN 18 44519516 critical splice donor site probably null
IGL02168:Mcc APN 18 44449299 missense probably damaging 0.97
IGL02449:Mcc APN 18 44459958 missense probably benign 0.10
IGL02613:Mcc APN 18 44429954 missense probably damaging 1.00
IGL02709:Mcc APN 18 44445810 missense possibly damaging 0.73
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0021:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0022:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0063:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0064:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0217:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0218:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0243:Mcc UTSW 18 44759299 missense probably benign
R0373:Mcc UTSW 18 44475222 missense probably benign 0.01
R0564:Mcc UTSW 18 44468507 missense probably damaging 1.00
R0604:Mcc UTSW 18 44473756 missense probably damaging 1.00
R0691:Mcc UTSW 18 44445860 missense possibly damaging 0.67
R0965:Mcc UTSW 18 44724526 missense probably benign 0.41
R1186:Mcc UTSW 18 44759403 missense probably benign
R1215:Mcc UTSW 18 44468494 missense possibly damaging 0.93
R1878:Mcc UTSW 18 44468400 missense possibly damaging 0.69
R1990:Mcc UTSW 18 44491315 nonsense probably null
R1991:Mcc UTSW 18 44491315 nonsense probably null
R1992:Mcc UTSW 18 44491315 nonsense probably null
R2186:Mcc UTSW 18 44812078 missense possibly damaging 0.71
R2189:Mcc UTSW 18 44534230 missense possibly damaging 0.93
R2258:Mcc UTSW 18 44475136 missense probably damaging 1.00
R2267:Mcc UTSW 18 44519541 missense probably damaging 0.99
R2310:Mcc UTSW 18 44431366 missense probably damaging 1.00
R2343:Mcc UTSW 18 44459797 critical splice donor site probably null
R2377:Mcc UTSW 18 44519549 missense probably damaging 1.00
R3110:Mcc UTSW 18 44449263 missense probably damaging 1.00
R3112:Mcc UTSW 18 44449263 missense probably damaging 1.00
R4135:Mcc UTSW 18 44724640 missense probably benign 0.03
R4404:Mcc UTSW 18 44759298 missense probably benign
R4600:Mcc UTSW 18 44519520 missense probably damaging 1.00
R4606:Mcc UTSW 18 44468421 missense probably damaging 0.96
R4721:Mcc UTSW 18 44519556 missense probably damaging 1.00
R5858:Mcc UTSW 18 44510141 missense probably damaging 0.98
R5997:Mcc UTSW 18 44449321 missense probably damaging 1.00
R6482:Mcc UTSW 18 44445864 missense possibly damaging 0.94
R6502:Mcc UTSW 18 44468390 nonsense probably null
R6502:Mcc UTSW 18 44468391 missense probably damaging 1.00
R6518:Mcc UTSW 18 44661811 start gained probably benign
R6796:Mcc UTSW 18 44724560 missense probably benign
R6846:Mcc UTSW 18 44473640 missense possibly damaging 0.63
R6879:Mcc UTSW 18 44812112 missense unknown
R7147:Mcc UTSW 18 44493513 missense probably damaging 0.99
R7475:Mcc UTSW 18 44476236 missense probably damaging 0.98
R7515:Mcc UTSW 18 44493432 missense probably benign 0.02
R7608:Mcc UTSW 18 44491227 missense possibly damaging 0.83
X0010:Mcc UTSW 18 44429957 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAATACTCAGCATACCCCTTGGAGC -3'
(R):5'- GCAAATCACAGGCAGATGTGGC -3'

Sequencing Primer
(F):5'- CTAGATAGCTTCCGCCTGTAGAG -3'
(R):5'- GGCATGTGTATTCATTGCATAGC -3'
Posted On2014-01-05