Mutagenetix > Incidental Mutation

Incidental Mutation 'R1015:Cep120'

96235

Institutional Source

Beutler Lab

Gene Symbol

Cep120

Ensembl Gene

ENSMUSG00000048799

Gene Name

centrosomal protein 120

Synonyms

Ccdc100

MMRRC Submission

039119-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R1015 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53681724-53744547 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 53703121 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000062433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049811]

AlphaFold

Q7TSG1

Predicted Effect

probably null
Transcript: ENSMUST00000049811

SMART Domains

Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799

Domain	Start	End	E-Value	Type
Pfam:C2	9	114	4.8e-5	PFAM
Pfam:DUF3668	118	340	1e-96	PFAM
low complexity region	378	396	N/A	INTRINSIC
Pfam:C2	520	568	1.9e-3	PFAM
low complexity region	632	642	N/A	INTRINSIC
SCOP:d1eq1a_	661	803	2e-4	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap3d1	A	G	10: 80,716,489	V615A	probably damaging	Het
Atp6v1d	A	G	12: 78,849,769	V108A	possibly damaging	Het
AU022751	GTCATCATCATCATC	GTCATCATCATCATCATC	X: 6,082,591		probably benign	Het
B3gnt6	C	A	7: 98,194,595	V53L	probably benign	Het
C8b	A	G	4: 104,786,960	K275E	probably benign	Het
Cage1	T	A	13: 38,016,475	N683I	possibly damaging	Het
Celsr3	T	C	9: 108,833,176	V1535A	probably benign	Het
Cep135	T	C	5: 76,640,997		probably null	Het
Chd9	T	A	8: 90,932,578	H55Q	probably damaging	Het
Dmxl2	G	A	9: 54,367,765	T2915I	probably benign	Het
Eps8l1	A	T	7: 4,469,933	D118V	probably damaging	Het
Galnt2	C	T	8: 124,336,617	H359Y	probably benign	Het
Gm8765	T	G	13: 50,701,628	V434G	possibly damaging	Het
Gm884	T	C	11: 103,545,796	H754R	probably benign	Het
Kdm5d	T	C	Y: 941,687	V1296A	possibly damaging	Het
Kif27	T	A	13: 58,320,215	K849N	probably damaging	Het
Kif5c	T	A	2: 49,744,365	D736E	probably benign	Het
Krt18	T	C	15: 102,031,300	I311T	probably benign	Het
Lamc2	A	T	1: 153,166,199	V63D	possibly damaging	Het
Lmbrd1	T	A	1: 24,731,878	C295*	probably null	Het
Map3k14	T	A	11: 103,225,300	Q767H	probably damaging	Het
Mapkapk5	T	C	5: 121,533,362	K203E	probably benign	Het
Mcc	C	A	18: 44,724,669	L126F	probably benign	Het
Mib1	T	A	18: 10,726,409	H35Q	probably damaging	Het
Myo16	A	G	8: 10,390,183	N412D	probably benign	Het
Ndst2	T	C	14: 20,730,064	Y36C	probably damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nwd2	T	C	5: 63,806,811	I1246T	probably damaging	Het
Olfr1034	T	C	2: 86,047,082	I200T	possibly damaging	Het
Olfr74	T	C	2: 87,974,087	T193A	probably benign	Het
Patl1	T	C	19: 11,920,373	V108A	probably benign	Het
Pdzd2	T	C	15: 12,374,508	E1847G	probably damaging	Het
Pla2g2f	C	T	4: 138,754,268	V57I	probably benign	Het
Prag1	T	C	8: 36,146,543	V1083A	probably damaging	Het
Slc3a2	C	T	19: 8,707,955	W227*	probably null	Het
Snx9	A	G	17: 5,920,127	I379M	probably benign	Het
Tacc2	A	G	7: 130,624,065	K846E	probably benign	Het
Taf4b	T	A	18: 14,813,098	V326E	probably damaging	Het
Tnrc6c	C	T	11: 117,721,922	S462F	possibly damaging	Het
Trim66	C	T	7: 109,455,233	V1257I	probably damaging	Het
Urb2	T	C	8: 124,029,434	Y627H	probably damaging	Het
Usp53	A	G	3: 122,933,759	L1058P	probably benign	Het
Wdr24	A	G	17: 25,828,238	S702G	probably benign	Het

Other mutations in Cep120

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01544:Cep120	APN	18	53685961	missense	probably benign	0.24
IGL01774:Cep120	APN	18	53706830	missense	possibly damaging	0.92
IGL01862:Cep120	APN	18	53714767	missense	probably benign	0.01
IGL01906:Cep120	APN	18	53714912	missense	probably benign
IGL01941:Cep120	APN	18	53723148	missense	probably benign	0.00
IGL02952:Cep120	APN	18	53683228	utr 3 prime	probably benign
IGL03248:Cep120	APN	18	53735772	missense	probably benign	0.04
IGL03379:Cep120	APN	18	53709136	missense	probably benign
R0019:Cep120	UTSW	18	53709047	splice site	probably benign
R0039:Cep120	UTSW	18	53685961	missense	probably benign	0.24
R0763:Cep120	UTSW	18	53721737	missense	probably benign	0.00
R1340:Cep120	UTSW	18	53724391	missense	probably damaging	1.00
R1507:Cep120	UTSW	18	53697657	missense	probably damaging	0.99
R1649:Cep120	UTSW	18	53724576	missense	probably damaging	1.00
R1727:Cep120	UTSW	18	53727729	missense	probably benign	0.01
R1739:Cep120	UTSW	18	53719214	critical splice donor site	probably null
R1873:Cep120	UTSW	18	53738488	missense	probably damaging	0.98
R1913:Cep120	UTSW	18	53723286	missense	probably benign	0.26
R1968:Cep120	UTSW	18	53723241	missense	probably benign	0.42
R1995:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2042:Cep120	UTSW	18	53735742	missense	possibly damaging	0.50
R2074:Cep120	UTSW	18	53719312	missense	possibly damaging	0.83
R2116:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2215:Cep120	UTSW	18	53727635	missense	probably damaging	1.00
R2697:Cep120	UTSW	18	53740125	missense	probably benign	0.00
R3813:Cep120	UTSW	18	53740212	splice site	probably benign
R4012:Cep120	UTSW	18	53738582	missense	probably damaging	0.99
R4368:Cep120	UTSW	18	53685885	splice site	probably null
R4615:Cep120	UTSW	18	53714841	missense	probably damaging	1.00
R4772:Cep120	UTSW	18	53718489	missense	probably damaging	1.00
R4780:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R5195:Cep120	UTSW	18	53721698	missense	probably damaging	1.00
R5991:Cep120	UTSW	18	53721798	missense	probably benign
R6156:Cep120	UTSW	18	53703223	missense	probably benign	0.00
R6188:Cep120	UTSW	18	53724457	missense	probably benign	0.03
R6688:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R6961:Cep120	UTSW	18	53703205	nonsense	probably null
R7143:Cep120	UTSW	18	53683385	missense	probably benign	0.00
R7282:Cep120	UTSW	18	53740089	missense	probably damaging	1.00
R7813:Cep120	UTSW	18	53738506	missense	probably damaging	1.00
R7818:Cep120	UTSW	18	53723103	missense	probably benign
R8677:Cep120	UTSW	18	53738561	missense	possibly damaging	0.90
R8724:Cep120	UTSW	18	53723127	missense	possibly damaging	0.88
R9164:Cep120	UTSW	18	53719246	missense	probably benign	0.02
R9225:Cep120	UTSW	18	53706824	missense	probably benign	0.00
R9300:Cep120	UTSW	18	53719297	missense	probably damaging	0.99
R9312:Cep120	UTSW	18	53727641	missense	probably benign	0.08
R9377:Cep120	UTSW	18	53718520	missense	possibly damaging	0.66
R9390:Cep120	UTSW	18	53706912	nonsense	probably null
R9499:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94
R9551:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GCTTCTACACATTCCCACTCAGACG -3'
(R):5'- GCCATTCCTTCAGGCATTAAGCCG -3'

Sequencing Primer
(F):5'- CCTTCTGACAAGGGTTGATTTC -3'
(R):5'- TCAGGCATTAAGCCGTTCAATC -3'

Posted On

2014-01-05