Incidental Mutation 'R1127:Eef1b2'
ID96249
Institutional Source Beutler Lab
Gene Symbol Eef1b2
Ensembl Gene ENSMUSG00000025967
Gene Nameeukaryotic translation elongation factor 1 beta 2
Synonyms
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1127 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63176825-63180486 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 63179457 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027108] [ENSMUST00000027111] [ENSMUST00000050536] [ENSMUST00000129339] [ENSMUST00000129339] [ENSMUST00000129339] [ENSMUST00000135877] [ENSMUST00000142062] [ENSMUST00000168099] [ENSMUST00000174890] [ENSMUST00000185412] [ENSMUST00000185732] [ENSMUST00000185847] [ENSMUST00000188370] [ENSMUST00000188524] [ENSMUST00000188524] [ENSMUST00000188524] [ENSMUST00000189664]
Predicted Effect probably benign
Transcript: ENSMUST00000027108
Predicted Effect probably benign
Transcript: ENSMUST00000027111
SMART Domains Protein: ENSMUSP00000027111
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 8.5e-20 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:NADH_dhqG_C 658 710 1.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050536
SMART Domains Protein: ENSMUSP00000051417
Gene: ENSMUSG00000046856

DomainStartEndE-ValueType
Pfam:7tm_1 55 302 3.9e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126469
Predicted Effect probably benign
Transcript: ENSMUST00000126795
SMART Domains Protein: ENSMUSP00000134341
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
SCOP:d1aw9_1 4 62 8e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129339
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129339
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000129339
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135877
SMART Domains Protein: ENSMUSP00000137671
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140612
Predicted Effect probably benign
Transcript: ENSMUST00000142062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148553
Predicted Effect probably benign
Transcript: ENSMUST00000168099
SMART Domains Protein: ENSMUSP00000126621
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.3e-19 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:DUF1982 657 710 3.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174890
SMART Domains Protein: ENSMUSP00000133545
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
Blast:WHEP 3 64 3e-6 BLAST
SCOP:d1aw9_1 7 65 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184516
Predicted Effect probably benign
Transcript: ENSMUST00000185412
SMART Domains Protein: ENSMUSP00000140467
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 79 5.3e-10 PFAM
Pfam:Fer2 34 79 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185732
SMART Domains Protein: ENSMUSP00000140307
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.4e-18 PFAM
Pfam:Fer2 34 97 6.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185827
Predicted Effect probably benign
Transcript: ENSMUST00000185847
SMART Domains Protein: ENSMUSP00000141190
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Molybdopterin 1 60 5.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188370
SMART Domains Protein: ENSMUSP00000139664
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 96 1.1e-13 PFAM
Pfam:Fer2 34 127 1.2e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000188524
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188524
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Predicted Effect probably null
Transcript: ENSMUST00000188524
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199062
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5' UTR. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Eef1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL00861:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL00862:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL00863:Eef1b2 APN 1 63178506 missense probably damaging 1.00
IGL01642:Eef1b2 APN 1 63177831 missense probably damaging 1.00
R1210:Eef1b2 UTSW 1 63177273 missense probably damaging 1.00
R1909:Eef1b2 UTSW 1 63177272 missense probably damaging 0.99
R2045:Eef1b2 UTSW 1 63179487 nonsense probably null
R5129:Eef1b2 UTSW 1 63179580 missense probably damaging 0.96
R6847:Eef1b2 UTSW 1 63178489 missense probably benign 0.32
R7748:Eef1b2 UTSW 1 63177865 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTCCATCCTACTAGACGTGAAGCC -3'
(R):5'- GTCATCTCAGCAGCCCAAGATTCAG -3'

Sequencing Primer
(F):5'- CTAGACGTGAAGCCTTGGGATG -3'
(R):5'- GAGCCAAGGGTTATCTTTCAAGC -3'
Posted On2014-01-05