Incidental Mutation 'R1127:Lamc1'

• ID: 96252
• Institutional Source: Beutler Lab
• Gene Symbol: Lamc1
• Ensembl Gene: ENSMUSG00000026478
• Gene Name: laminin, gamma 1
• Synonyms: laminin B2, Lamb2
• MMRRC Submission: 039200-MU
• Essential gene?: Essential (E-score: 1.000)
• Stock #: R1127 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 1
• Chromosomal Location: 153218922-153332786 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): A to G at 153250459 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Phenylalanine to Leucine at position 496 (F496L)
• Ref Sequence: ENSEMBL: ENSMUSP00000027752
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000027752]
• AlphaFold: no structure available at present
• Predicted Effect: possibly damaging; Transcript: ENSMUST00000027752; AA Change: F496L; PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
• SMART Domains: Protein: ENSMUSP00000027752; Gene: ENSMUSG00000026478; AA Change: F496L

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

• Predicted Effect: noncoding transcript; Transcript: ENSMUST00000159251
• Coding Region Coverage:
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011] ; PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
• Posted On: 2014-01-05

Predicted Primers

PCR Primer
(F):5'- TGTCCTCATTAAAGGGCCACACAAG -3'
(R):5'- TGCCGTCGTGTAAAACGGGTTG -3'

Sequencing Primer
(F):5'- GTATCAAAAACACTCCCAAGTTACTG -3'
(R):5'- ATCCTTCGGGCAGCACAG -3'