Incidental Mutation 'R1127:Pamr1'
ID96260
Institutional Source Beutler Lab
Gene Symbol Pamr1
Ensembl Gene ENSMUSG00000027188
Gene Namepeptidase domain containing associated with muscle regeneration 1
SynonymsRAMP, E430002G05Rik
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1127 (G1)
Quality Score158
Status Not validated
Chromosome2
Chromosomal Location102550012-102643041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102639353 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 415 (I415F)
Ref Sequence ENSEMBL: ENSMUSP00000028612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028612]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028612
AA Change: I415F

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028612
Gene: ENSMUSG00000027188
AA Change: I415F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 84 126 1.18e1 SMART
CUB 128 236 1.07e-33 SMART
EGF 238 272 4.12e-7 SMART
CCP 280 342 1.3e-9 SMART
CCP 389 442 6.7e-3 SMART
Tryp_SPc 444 715 1.02e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144333
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Pamr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Pamr1 APN 2 102642272 missense possibly damaging 0.80
IGL00741:Pamr1 APN 2 102586621 missense possibly damaging 0.62
IGL00928:Pamr1 APN 2 102639341 missense probably benign 0.01
IGL01328:Pamr1 APN 2 102642137 missense probably benign 0.00
IGL02621:Pamr1 APN 2 102634343 missense probably benign 0.03
IGL02732:Pamr1 APN 2 102642141 missense probably benign 0.03
R0020:Pamr1 UTSW 2 102642078 missense probably benign 0.19
R0743:Pamr1 UTSW 2 102609907 missense probably damaging 1.00
R1068:Pamr1 UTSW 2 102642245 missense probably damaging 1.00
R1711:Pamr1 UTSW 2 102640852 missense probably benign 0.28
R1912:Pamr1 UTSW 2 102642300 missense probably damaging 1.00
R1926:Pamr1 UTSW 2 102640997 intron probably null
R1937:Pamr1 UTSW 2 102642272 missense possibly damaging 0.80
R2021:Pamr1 UTSW 2 102634535 missense probably benign 0.00
R2023:Pamr1 UTSW 2 102634535 missense probably benign 0.00
R4718:Pamr1 UTSW 2 102642336 missense probably damaging 1.00
R4934:Pamr1 UTSW 2 102642204 missense probably benign 0.21
R5268:Pamr1 UTSW 2 102586684 missense probably damaging 0.98
R5450:Pamr1 UTSW 2 102639317 missense probably damaging 0.98
R5864:Pamr1 UTSW 2 102634348 missense possibly damaging 0.91
R6112:Pamr1 UTSW 2 102611608 missense probably damaging 1.00
R6286:Pamr1 UTSW 2 102640948 nonsense probably null
R6327:Pamr1 UTSW 2 102642174 missense probably damaging 1.00
R6831:Pamr1 UTSW 2 102614931 missense probably damaging 0.97
R6834:Pamr1 UTSW 2 102614931 missense probably damaging 0.97
R6980:Pamr1 UTSW 2 102642204 missense probably benign 0.21
R7000:Pamr1 UTSW 2 102611623 missense probably damaging 1.00
R7073:Pamr1 UTSW 2 102640935 missense probably benign 0.00
R7255:Pamr1 UTSW 2 102611584 missense probably damaging 1.00
R7357:Pamr1 UTSW 2 102586704 nonsense probably null
R7851:Pamr1 UTSW 2 102586600 missense probably benign 0.02
R7934:Pamr1 UTSW 2 102586600 missense probably benign 0.02
X0067:Pamr1 UTSW 2 102639335 nonsense probably null
Z1088:Pamr1 UTSW 2 102634446 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGGGAACTGGATGCTAAAGTCTTGC -3'
(R):5'- ATCGATGGGAGAAAATCCCCTTGC -3'

Sequencing Primer
(F):5'- AACTGGATGCTAAAGTCTTGCTTTTG -3'
(R):5'- GGAGAAAATCCCCTTGCTCAATTAAG -3'
Posted On2014-01-05