Incidental Mutation 'R1127:Gm5538'
ID96266
Institutional Source Beutler Lab
Gene Symbol Gm5538
Ensembl Gene ENSMUSG00000090527
Gene Namepredicted gene 5538
Synonyms
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1127 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59729790-59752333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59751893 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 256 (E256K)
Ref Sequence ENSEMBL: ENSMUSP00000128877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168156]
Predicted Effect probably benign
Transcript: ENSMUST00000168156
AA Change: E256K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128877
Gene: ENSMUSG00000090527
AA Change: E256K

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:DUF2424 70 214 9.3e-9 PFAM
Pfam:COesterase 91 236 5.4e-10 PFAM
Pfam:Abhydrolase_3 107 287 6.6e-36 PFAM
Pfam:Abhydrolase_3 271 375 1.4e-13 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Gm5538
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Gm5538 APN 3 59752121 missense possibly damaging 0.91
IGL00934:Gm5538 APN 3 59752053 missense probably benign 0.00
IGL02335:Gm5538 APN 3 59743605 missense probably benign
IGL02709:Gm5538 APN 3 59747198 missense probably damaging 1.00
IGL03114:Gm5538 APN 3 59743723 missense possibly damaging 0.55
R0107:Gm5538 UTSW 3 59752316 missense possibly damaging 0.78
R0591:Gm5538 UTSW 3 59752129 nonsense probably null
R0850:Gm5538 UTSW 3 59752248 missense possibly damaging 0.80
R1916:Gm5538 UTSW 3 59745503 missense possibly damaging 0.48
R3008:Gm5538 UTSW 3 59745509 missense possibly damaging 0.93
R3921:Gm5538 UTSW 3 59752077 missense probably damaging 0.98
R4368:Gm5538 UTSW 3 59751966 missense probably damaging 1.00
R5240:Gm5538 UTSW 3 59752028 missense probably damaging 0.99
R5268:Gm5538 UTSW 3 59752023 missense probably damaging 0.99
R5511:Gm5538 UTSW 3 59747264 missense probably damaging 1.00
R5564:Gm5538 UTSW 3 59752092 missense probably benign
R5812:Gm5538 UTSW 3 59747272 missense probably damaging 1.00
R5981:Gm5538 UTSW 3 59751878 missense probably benign
R6049:Gm5538 UTSW 3 59752149 missense probably damaging 1.00
R6195:Gm5538 UTSW 3 59752202 missense probably damaging 0.98
R6353:Gm5538 UTSW 3 59752108 missense probably damaging 1.00
R6449:Gm5538 UTSW 3 59745551 missense probably damaging 1.00
R6845:Gm5538 UTSW 3 59752118 missense probably damaging 1.00
R7382:Gm5538 UTSW 3 59743616 missense probably benign 0.18
R7585:Gm5538 UTSW 3 59743722 missense possibly damaging 0.94
R7827:Gm5538 UTSW 3 59743691 missense probably damaging 0.99
R7844:Gm5538 UTSW 3 59729897 missense probably benign 0.32
R7927:Gm5538 UTSW 3 59729897 missense probably benign 0.32
Z1176:Gm5538 UTSW 3 59747194 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGCTATCATCTCTGGGACTTCCTTGA -3'
(R):5'- AGCCGTGTGCTGTAAATAAGACCATC -3'

Sequencing Primer
(F):5'- CATACTGTGAATAACTGCATGGG -3'
(R):5'- CTGCTATCCAAAAGTGCTGG -3'
Posted On2014-01-05