Incidental Mutation 'R1016:Nans'
ID96267
Institutional Source Beutler Lab
Gene Symbol Nans
Ensembl Gene ENSMUSG00000028334
Gene NameN-acetylneuraminic acid synthase (sialic acid synthase)
Synonyms4632418E04Rik, N-acetylneuraminic acid phosphate synthase, Sas
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location46489248-46503632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46500716 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 203 (Y203H)
Ref Sequence ENSEMBL: ENSMUSP00000030018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030018] [ENSMUST00000184112]
Predicted Effect probably benign
Transcript: ENSMUST00000030018
AA Change: Y203H

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030018
Gene: ENSMUSG00000028334
AA Change: Y203H

DomainStartEndE-ValueType
Pfam:NeuB 39 278 4.7e-81 PFAM
SAF 292 351 2.38e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150584
Predicted Effect probably benign
Transcript: ENSMUST00000184112
SMART Domains Protein: ENSMUSP00000138876
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that functions in the biosynthetic pathways of sialic acids. In vitro, the encoded protein uses N-acetylmannosamine 6-phosphate and mannose 6-phosphate as substrates to generate phosphorylated forms of N-acetylneuraminic acid (Neu5Ac) and 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid (KDN), respectively; however, it exhibits much higher activity toward the Neu5Ac phosphate product. In insect cells, expression of this gene results in Neu5Ac and KDN production. This gene is related to the E. coli sialic acid synthase gene neuB, and it can partially restore sialic acid synthase activity in an E. coli neuB-negative mutant. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Nans
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1192:Nans UTSW 4 46502430 intron probably benign
R1493:Nans UTSW 4 46500761 missense probably damaging 1.00
R1912:Nans UTSW 4 46500162 missense probably damaging 1.00
R3799:Nans UTSW 4 46492839 missense probably benign 0.05
R4980:Nans UTSW 4 46492764 missense probably benign 0.03
R5212:Nans UTSW 4 46502547 missense possibly damaging 0.56
R5723:Nans UTSW 4 46499083 missense probably benign 0.08
R5854:Nans UTSW 4 46500180 missense probably damaging 1.00
R5990:Nans UTSW 4 46489441 missense probably damaging 0.99
R7474:Nans UTSW 4 46502484 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCAGCCGCCCTCAATGAGAG -3'
(R):5'- TCATCCTGAGCAAGTGTGTCGCC -3'

Sequencing Primer
(F):5'- TGGTCAGAGTGCCTTACTGT -3'
(R):5'- ATTGCAGGCCATCTCACAGG -3'
Posted On2014-01-05