Incidental Mutation 'R1016:Cyp2j12'
ID96273
Institutional Source Beutler Lab
Gene Symbol Cyp2j12
Ensembl Gene ENSMUSG00000081225
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 12
SynonymsOTTMUSG00000007939, Cyp2j12-ps
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96099318-96141152 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 96112865 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097972] [ENSMUST00000097972] [ENSMUST00000121694]
Predicted Effect probably null
Transcript: ENSMUST00000097972
SMART Domains Protein: ENSMUSP00000133811
Gene: ENSMUSG00000081225

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 498 8.2e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097972
SMART Domains Protein: ENSMUSP00000133811
Gene: ENSMUSG00000081225

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 498 8.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121694
SMART Domains Protein: ENSMUSP00000134394
Gene: ENSMUSG00000081225

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
SCOP:d1cpt__ 39 70 2e-8 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Cyp2j12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Cyp2j12 APN 4 96106589 splice site probably benign
IGL01655:Cyp2j12 APN 4 96115577 missense possibly damaging 0.79
IGL01723:Cyp2j12 APN 4 96102126 missense possibly damaging 0.56
IGL01737:Cyp2j12 APN 4 96122658 makesense probably null
IGL01936:Cyp2j12 APN 4 96133069 missense probably benign 0.01
IGL01962:Cyp2j12 APN 4 96099762 missense probably benign 0.10
IGL02691:Cyp2j12 APN 4 96132994 critical splice donor site probably null
R0255:Cyp2j12 UTSW 4 96141025 missense probably benign 0.38
R0613:Cyp2j12 UTSW 4 96102079 missense probably damaging 1.00
R0827:Cyp2j12 UTSW 4 96112862 splice site probably benign
R1251:Cyp2j12 UTSW 4 96115666 nonsense probably null
R1753:Cyp2j12 UTSW 4 96121432 splice site probably null
R2258:Cyp2j12 UTSW 4 96133078 missense probably damaging 1.00
R4471:Cyp2j12 UTSW 4 96133069 missense probably benign 0.01
R4559:Cyp2j12 UTSW 4 96112957 missense probably damaging 0.99
R4702:Cyp2j12 UTSW 4 96132993 critical splice donor site probably null
R4923:Cyp2j12 UTSW 4 96102109 missense possibly damaging 0.91
R4928:Cyp2j12 UTSW 4 96102151 splice site probably null
R5591:Cyp2j12 UTSW 4 96141122 start gained probably benign
R5897:Cyp2j12 UTSW 4 96102042 missense probably damaging 1.00
R6176:Cyp2j12 UTSW 4 96140837 missense probably damaging 0.99
R6942:Cyp2j12 UTSW 4 96112864 critical splice donor site probably null
R7422:Cyp2j12 UTSW 4 96140985 missense probably benign 0.05
R7453:Cyp2j12 UTSW 4 96102126 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCGTCTTACAGCACATGGCACAG -3'
(R):5'- AAGCTCTCACTTGGATGAGAACATCAC -3'

Sequencing Primer
(F):5'- ccccttccccctttagcc -3'
(R):5'- TGAGAACATCACTGTCCAATGAG -3'
Posted On2014-01-05