Incidental Mutation 'R1016:Mpl'
ID 96279
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Name myeloproliferative leukemia virus oncogene
Synonyms c-mpl-I, TPO-R, thrombopoietin receptor, c-mpl, CD110, hlb219, c-mpl-II
MMRRC Submission 039120-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1016 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118299612-118314710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118306110 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 310 (Y310C)
Ref Sequence ENSEMBL: ENSMUSP00000101983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]
AlphaFold Q08351
Predicted Effect
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389
AA Change: Y377C

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102671
AA Change: Y369C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389
AA Change: Y369C

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106375
AA Change: Y310C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389
AA Change: Y310C

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389
AA Change: Y376C

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,710,227 (GRCm39) H6Q probably null Het
Clstn1 T C 4: 149,731,286 (GRCm39) I866T probably benign Het
Cntnap1 T C 11: 101,068,333 (GRCm39) V86A probably damaging Het
Crtc1 A T 8: 70,844,769 (GRCm39) Y351* probably null Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Cyp2j12 C T 4: 96,001,102 (GRCm39) probably null Het
Dmrt2 A T 19: 25,652,938 (GRCm39) K183N probably damaging Het
Fancl G T 11: 26,337,195 (GRCm39) probably benign Het
Fbxo40 G A 16: 36,789,539 (GRCm39) Q524* probably null Het
Flcn T C 11: 59,686,691 (GRCm39) probably null Het
Gm19965 T A 1: 116,749,031 (GRCm39) C237* probably null Het
Hpf1 A G 8: 61,348,678 (GRCm39) Y131C possibly damaging Het
Mdh1 A G 11: 21,509,769 (GRCm39) L202P probably benign Het
Mtus1 A G 8: 41,503,063 (GRCm39) V784A probably benign Het
Myg1 T C 15: 102,242,786 (GRCm39) I159T possibly damaging Het
Nans T C 4: 46,500,716 (GRCm39) Y203H probably benign Het
Ncapg2 G A 12: 116,402,295 (GRCm39) C709Y probably damaging Het
Or8b36 T C 9: 37,937,987 (GRCm39) V295A probably damaging Het
Parp12 T C 6: 39,088,660 (GRCm39) Y192C probably damaging Het
Plekha6 A G 1: 133,187,832 (GRCm39) N118D probably benign Het
Prg4 T C 1: 150,330,442 (GRCm39) probably benign Het
Psip1 T C 4: 83,378,135 (GRCm39) T454A possibly damaging Het
Ptprz1 T C 6: 23,000,973 (GRCm39) L1021P probably damaging Het
Pvr T C 7: 19,643,142 (GRCm39) I364V probably benign Het
Serpina5 A G 12: 104,071,582 (GRCm39) I396M probably damaging Het
Sgcb A C 5: 73,797,183 (GRCm39) H192Q probably benign Het
Slc4a9 C A 18: 36,664,478 (GRCm39) H379N probably benign Het
Tet1 T C 10: 62,715,729 (GRCm39) D22G probably benign Het
Trim34a T C 7: 103,897,167 (GRCm39) V77A probably benign Het
Ttc7b T C 12: 100,369,617 (GRCm39) E384G probably null Het
Vmn2r16 G A 5: 109,487,754 (GRCm39) G209D probably damaging Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118,312,858 (GRCm39) missense possibly damaging 0.94
IGL02096:Mpl APN 4 118,314,333 (GRCm39) missense possibly damaging 0.46
IGL02681:Mpl APN 4 118,306,068 (GRCm39) splice site probably benign
R0238:Mpl UTSW 4 118,314,060 (GRCm39) splice site probably benign
R0309:Mpl UTSW 4 118,303,235 (GRCm39) intron probably benign
R0539:Mpl UTSW 4 118,300,705 (GRCm39) missense possibly damaging 0.68
R0558:Mpl UTSW 4 118,301,217 (GRCm39) missense probably damaging 0.99
R0601:Mpl UTSW 4 118,300,733 (GRCm39) missense probably benign 0.08
R0784:Mpl UTSW 4 118,303,603 (GRCm39) missense possibly damaging 0.59
R1532:Mpl UTSW 4 118,305,765 (GRCm39) missense possibly damaging 0.63
R1590:Mpl UTSW 4 118,301,221 (GRCm39) missense probably damaging 0.99
R1806:Mpl UTSW 4 118,300,729 (GRCm39) missense possibly damaging 0.73
R1875:Mpl UTSW 4 118,314,026 (GRCm39) missense probably benign
R1935:Mpl UTSW 4 118,312,936 (GRCm39) missense probably benign 0.01
R2182:Mpl UTSW 4 118,314,610 (GRCm39) missense probably benign
R2291:Mpl UTSW 4 118,306,197 (GRCm39) missense probably benign 0.04
R2508:Mpl UTSW 4 118,312,954 (GRCm39) missense probably damaging 1.00
R4242:Mpl UTSW 4 118,313,968 (GRCm39) missense probably damaging 0.98
R4718:Mpl UTSW 4 118,313,921 (GRCm39) missense probably benign 0.02
R4775:Mpl UTSW 4 118,305,777 (GRCm39) missense probably damaging 1.00
R5158:Mpl UTSW 4 118,313,881 (GRCm39) missense probably damaging 0.98
R5208:Mpl UTSW 4 118,313,078 (GRCm39) missense probably benign 0.00
R5276:Mpl UTSW 4 118,312,918 (GRCm39) missense probably benign
R5953:Mpl UTSW 4 118,311,708 (GRCm39) missense probably damaging 0.99
R5953:Mpl UTSW 4 118,311,707 (GRCm39) missense possibly damaging 0.89
R6439:Mpl UTSW 4 118,305,750 (GRCm39) missense probably damaging 0.98
R6450:Mpl UTSW 4 118,305,897 (GRCm39) splice site probably null
R6521:Mpl UTSW 4 118,312,314 (GRCm39) critical splice donor site probably null
R6812:Mpl UTSW 4 118,312,461 (GRCm39) missense probably benign 0.03
R6876:Mpl UTSW 4 118,314,317 (GRCm39) missense probably damaging 1.00
R7095:Mpl UTSW 4 118,301,260 (GRCm39) missense
R7100:Mpl UTSW 4 118,314,607 (GRCm39) missense
R7173:Mpl UTSW 4 118,305,741 (GRCm39) critical splice donor site probably null
R7177:Mpl UTSW 4 118,305,741 (GRCm39) critical splice donor site probably null
R7512:Mpl UTSW 4 118,306,089 (GRCm39) missense
R8377:Mpl UTSW 4 118,301,254 (GRCm39) missense
R8411:Mpl UTSW 4 118,303,306 (GRCm39) missense
R8458:Mpl UTSW 4 118,301,213 (GRCm39) critical splice donor site probably null
R8498:Mpl UTSW 4 118,306,207 (GRCm39) missense probably benign
R8672:Mpl UTSW 4 118,306,110 (GRCm39) missense probably damaging 1.00
R8863:Mpl UTSW 4 118,314,602 (GRCm39) missense
R8904:Mpl UTSW 4 118,301,263 (GRCm39) missense
Z1177:Mpl UTSW 4 118,300,852 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ACCACAGTGAATTAGGCATCAGGC -3'
(R):5'- GAGACTGGACCTCATTCAGGCAAAG -3'

Sequencing Primer
(F):5'- TTAGGCATCAGGCCACCAG -3'
(R):5'- GGACTTCAGTCACGATCCATGTAG -3'
Posted On 2014-01-05