Incidental Mutation 'R1127:C87977'
ID96280
Institutional Source Beutler Lab
Gene Symbol C87977
Ensembl Gene ENSMUSG00000046262
Gene Nameexpressed sequence C87977
Synonyms
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1127 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144206775-144213318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144207124 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 471 (T471I)
Ref Sequence ENSEMBL: ENSMUSP00000101383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105753] [ENSMUST00000105754] [ENSMUST00000105755] [ENSMUST00000105757] [ENSMUST00000146836] [ENSMUST00000147855]
Predicted Effect probably benign
Transcript: ENSMUST00000105753
Predicted Effect probably benign
Transcript: ENSMUST00000105754
Predicted Effect probably damaging
Transcript: ENSMUST00000105755
AA Change: T301I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101381
Gene: ENSMUSG00000046262
AA Change: T301I

DomainStartEndE-ValueType
SCOP:d1a4ya_ 52 250 9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105757
AA Change: T471I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101383
Gene: ENSMUSG00000046262
AA Change: T471I

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 420 1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132946
Predicted Effect probably benign
Transcript: ENSMUST00000146836
Predicted Effect probably benign
Transcript: ENSMUST00000147855
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in C87977
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:C87977 APN 4 144208475 missense possibly damaging 0.58
IGL02950:C87977 APN 4 144212961 missense probably benign 0.06
IGL03174:C87977 APN 4 144208430 missense probably benign
IGL03178:C87977 APN 4 144208251 critical splice donor site probably null
PIT4812001:C87977 UTSW 4 144209516 missense probably benign
R0622:C87977 UTSW 4 144213013 unclassified probably benign
R0634:C87977 UTSW 4 144209340 critical splice donor site probably null
R1341:C87977 UTSW 4 144207559 missense probably damaging 1.00
R1697:C87977 UTSW 4 144208592 missense probably damaging 1.00
R1827:C87977 UTSW 4 144209610 missense probably damaging 0.99
R1857:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R2859:C87977 UTSW 4 144209622 missense probably benign 0.11
R4063:C87977 UTSW 4 144208695 missense possibly damaging 0.87
R4114:C87977 UTSW 4 144209603 missense probably damaging 1.00
R4130:C87977 UTSW 4 144208809 missense probably damaging 0.99
R4255:C87977 UTSW 4 144207484 missense possibly damaging 0.68
R4704:C87977 UTSW 4 144208592 missense probably damaging 1.00
R4840:C87977 UTSW 4 144208574 missense probably damaging 0.98
R5267:C87977 UTSW 4 144213005 unclassified probably benign
R5670:C87977 UTSW 4 144209622 missense probably benign 0.11
R6149:C87977 UTSW 4 144207413 missense probably damaging 0.98
R6508:C87977 UTSW 4 144207601 nonsense probably null
R6528:C87977 UTSW 4 144208811 missense probably damaging 0.99
R7252:C87977 UTSW 4 144212940 missense possibly damaging 0.95
R7564:C87977 UTSW 4 144212955 missense probably damaging 1.00
R7704:C87977 UTSW 4 144208521 missense possibly damaging 0.74
Z1176:C87977 UTSW 4 144207461 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATCCATTCACCAGCTCAGAGGAAG -3'
(R):5'- GCCTGCCCTAAGCCAATTATCTCAC -3'

Sequencing Primer
(F):5'- TAGGTGATTGACATTTTCATGCTCC -3'
(R):5'- CACCTCAGAGAGGTCAGTTTCTATG -3'
Posted On2014-01-05