Incidental Mutation 'R1016:Sgcb'
ID96289
Institutional Source Beutler Lab
Gene Symbol Sgcb
Ensembl Gene ENSMUSG00000029156
Gene Namesarcoglycan, beta (dystrophin-associated glycoprotein)
Synonymsbeta-SG
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73632749-73647790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73639840 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 192 (H192Q)
Ref Sequence ENSEMBL: ENSMUSP00000079937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081170]
Predicted Effect probably benign
Transcript: ENSMUST00000081170
AA Change: H192Q

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079937
Gene: ENSMUSG00000029156
AA Change: H192Q

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 56 305 4.3e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201416
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sarcoglycan family. Sarcoglycans are transmembrane components in the dystrophin-glycoprotein complex which help stabilize the muscle fiber membranes and link the muscle cytoskeleton to the extracellular matrix. Mutations in this gene have been associated with limb-girdle muscular dystrophy.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit muscular dystrophy and cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Parp12 T C 6: 39,111,726 Y192C probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Sgcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Sgcb APN 5 73635678 missense possibly damaging 0.92
IGL02504:Sgcb APN 5 73644375 missense probably damaging 0.96
IGL03330:Sgcb APN 5 73639869 missense probably damaging 1.00
PIT4445001:Sgcb UTSW 5 73639812 missense probably damaging 0.99
R0708:Sgcb UTSW 5 73640882 splice site probably null
R1119:Sgcb UTSW 5 73644414 missense probably damaging 1.00
R1293:Sgcb UTSW 5 73635527 missense probably benign 0.13
R1464:Sgcb UTSW 5 73635553 missense probably benign 0.05
R1464:Sgcb UTSW 5 73635553 missense probably benign 0.05
R2762:Sgcb UTSW 5 73635709 splice site probably null
R5499:Sgcb UTSW 5 73644405 missense probably damaging 0.99
R6120:Sgcb UTSW 5 73640810 missense possibly damaging 0.62
R6809:Sgcb UTSW 5 73640693 missense probably benign 0.03
R7484:Sgcb UTSW 5 73639845 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AACTCTGGACTATGCAAGGCAGGC -3'
(R):5'- TCGCATCCTTTGAGAACAGACTCAC -3'

Sequencing Primer
(F):5'- TGTGCAGGCTAAGGCCAG -3'
(R):5'- TTTGAGAACAGACTCACAATGAAGC -3'
Posted On2014-01-05