Incidental Mutation 'R1016:Parp12'
ID96299
Institutional Source Beutler Lab
Gene Symbol Parp12
Ensembl Gene ENSMUSG00000038507
Gene Namepoly (ADP-ribose) polymerase family, member 12
SynonymsZc3hdc1
MMRRC Submission 039120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R1016 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39086410-39118349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39111726 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 192 (Y192C)
Ref Sequence ENSEMBL: ENSMUSP00000039704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038398]
Predicted Effect probably damaging
Transcript: ENSMUST00000038398
AA Change: Y192C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039704
Gene: ENSMUSG00000038507
AA Change: Y192C

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 17 32 N/A INTRINSIC
low complexity region 51 83 N/A INTRINSIC
ZnF_C3H1 99 127 2.79e1 SMART
ZnF_C3H1 186 210 1.36e-2 SMART
ZnF_C3H1 280 306 2.03e1 SMART
Pfam:WWE 385 468 1.3e-16 PFAM
Pfam:PARP 506 689 5.2e-48 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ceacam20 T A 7: 19,976,302 H6Q probably null Het
Clstn1 T C 4: 149,646,829 I866T probably benign Het
Cntnap1 T C 11: 101,177,507 V86A probably damaging Het
Crtc1 A T 8: 70,392,119 Y351* probably null Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cyp2j12 C T 4: 96,112,865 probably null Het
Dmrt2 A T 19: 25,675,574 K183N probably damaging Het
Fancl G T 11: 26,387,195 probably benign Het
Fbxo40 G A 16: 36,969,177 Q524* probably null Het
Flcn T C 11: 59,795,865 probably null Het
Gm19965 T A 1: 116,821,301 C237* probably null Het
Hpf1 A G 8: 60,895,644 Y131C possibly damaging Het
Mdh1 A G 11: 21,559,769 L202P probably benign Het
Mpl T C 4: 118,448,913 Y310C probably damaging Het
Mtus1 A G 8: 41,050,026 V784A probably benign Het
Myg1 T C 15: 102,334,351 I159T possibly damaging Het
Nans T C 4: 46,500,716 Y203H probably benign Het
Ncapg2 G A 12: 116,438,675 C709Y probably damaging Het
Olfr883 T C 9: 38,026,691 V295A probably damaging Het
Plekha6 A G 1: 133,260,094 N118D probably benign Het
Prg4 T C 1: 150,454,691 probably benign Het
Psip1 T C 4: 83,459,898 T454A possibly damaging Het
Ptprz1 T C 6: 23,000,974 L1021P probably damaging Het
Pvr T C 7: 19,909,217 I364V probably benign Het
Serpina5 A G 12: 104,105,323 I396M probably damaging Het
Sgcb A C 5: 73,639,840 H192Q probably benign Het
Slc4a9 C A 18: 36,531,425 H379N probably benign Het
Tet1 T C 10: 62,879,950 D22G probably benign Het
Trim34a T C 7: 104,247,960 V77A probably benign Het
Ttc7b T C 12: 100,403,358 E384G probably null Het
Vmn2r16 G A 5: 109,339,888 G209D probably damaging Het
Other mutations in Parp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02199:Parp12 APN 6 39096590 missense probably benign 0.01
IGL02937:Parp12 APN 6 39102581 missense probably damaging 1.00
IGL03032:Parp12 APN 6 39087586 unclassified probably null
IGL03149:Parp12 APN 6 39114231 missense probably benign 0.07
IGL03365:Parp12 APN 6 39102647 missense probably damaging 1.00
I1329:Parp12 UTSW 6 39087571 missense probably damaging 1.00
R1446:Parp12 UTSW 6 39102561 missense probably benign 0.00
R1640:Parp12 UTSW 6 39096640 missense probably benign 0.38
R1640:Parp12 UTSW 6 39111678 missense probably damaging 1.00
R4794:Parp12 UTSW 6 39117810 missense probably benign 0.02
R5324:Parp12 UTSW 6 39102612 missense probably damaging 0.99
R5411:Parp12 UTSW 6 39090208 missense probably damaging 1.00
R6862:Parp12 UTSW 6 39111736 missense probably benign 0.02
R6864:Parp12 UTSW 6 39111736 missense probably benign 0.02
R6865:Parp12 UTSW 6 39111736 missense probably benign 0.02
R7124:Parp12 UTSW 6 39111736 missense probably benign 0.02
R7126:Parp12 UTSW 6 39111736 missense probably benign 0.02
R8050:Parp12 UTSW 6 39089104 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCACTTTCCATTAGCCTTACC -3'
(R):5'- GCCAACTTTGAGATGCCTTAGCCC -3'

Sequencing Primer
(F):5'- AGACACTTTGCTGAGGGC -3'
(R):5'- TTGAGATGCCTTAGCCCTAAGAAC -3'
Posted On2014-01-05