Incidental Mutation 'R1127:Olfr651'
ID96302
Institutional Source Beutler Lab
Gene Symbol Olfr651
Ensembl Gene ENSMUSG00000073928
Gene Nameolfactory receptor 651
SynonymsGA_x6K02T2PBJ9-7179540-7180481, MOR31-11
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1127 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104550133-104554422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104553086 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 56 (H56N)
Ref Sequence ENSEMBL: ENSMUSP00000150776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098176] [ENSMUST00000216904]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098176
AA Change: H56N

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095778
Gene: ENSMUSG00000073928
AA Change: H56N

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 4.1e-104 PFAM
Pfam:7TM_GPCR_Srsx 35 303 1e-10 PFAM
Pfam:7tm_1 41 292 4.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216246
Predicted Effect possibly damaging
Transcript: ENSMUST00000216904
AA Change: H56N

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Olfr651
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Olfr651 APN 7 104553092 missense probably benign 0.18
IGL01120:Olfr651 APN 7 104553345 missense probably benign
IGL01325:Olfr651 APN 7 104553689 missense probably damaging 1.00
IGL01590:Olfr651 APN 7 104553575 missense probably benign 0.00
IGL02625:Olfr651 APN 7 104553573 missense probably damaging 1.00
IGL02685:Olfr651 APN 7 104553150 missense probably benign 0.35
P0157:Olfr651 UTSW 7 104553507 missense probably damaging 1.00
R0087:Olfr651 UTSW 7 104553662 missense possibly damaging 0.73
R0399:Olfr651 UTSW 7 104553369 missense probably benign 0.05
R0547:Olfr651 UTSW 7 104553356 missense probably benign 0.01
R0630:Olfr651 UTSW 7 104553791 missense probably benign 0.27
R1014:Olfr651 UTSW 7 104553176 missense probably damaging 1.00
R1724:Olfr651 UTSW 7 104553228 missense probably damaging 1.00
R2473:Olfr651 UTSW 7 104552939 missense possibly damaging 0.93
R3115:Olfr651 UTSW 7 104553088 missense probably benign 0.13
R3116:Olfr651 UTSW 7 104553088 missense probably benign 0.13
R3834:Olfr651 UTSW 7 104553345 missense probably benign 0.43
R4027:Olfr651 UTSW 7 104553323 missense possibly damaging 0.90
R4423:Olfr651 UTSW 7 104553345 missense probably benign
R4907:Olfr651 UTSW 7 104553311 missense probably damaging 0.97
R4984:Olfr651 UTSW 7 104553021 missense probably benign 0.38
R5266:Olfr651 UTSW 7 104553819 missense probably benign 0.00
R5592:Olfr651 UTSW 7 104553731 missense probably benign 0.28
R6441:Olfr651 UTSW 7 104553335 nonsense probably null
R7463:Olfr651 UTSW 7 104553482 missense possibly damaging 0.88
R7647:Olfr651 UTSW 7 104553686 missense probably benign 0.00
X0067:Olfr651 UTSW 7 104553387 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTTGTCCTCAGGCTCAAGAACCAG -3'
(R):5'- AGAAGCTCCTCACAATGATGCTCAC -3'

Sequencing Primer
(F):5'- AGATACCACAGAGGCCATGTATAAC -3'
(R):5'- TCTTGACAATCACCTGCGGAG -3'
Posted On2014-01-05