Incidental Mutation 'R1127:Xylb'
ID96315
Institutional Source Beutler Lab
Gene Symbol Xylb
Ensembl Gene ENSMUSG00000035769
Gene Namexylulokinase homolog (H. influenzae)
Synonyms
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1127 (G1)
Quality Score177
Status Not validated
Chromosome9
Chromosomal Location119357381-119393797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119383377 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 427 (I427T)
Ref Sequence ENSEMBL: ENSMUSP00000047254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039610] [ENSMUST00000215822] [ENSMUST00000216838]
Predicted Effect probably damaging
Transcript: ENSMUST00000039610
AA Change: I427T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047254
Gene: ENSMUSG00000035769
AA Change: I427T

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
Pfam:FGGY_N 144 302 3.9e-15 PFAM
Pfam:FGGY_C 310 496 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213383
Predicted Effect probably benign
Transcript: ENSMUST00000215822
Predicted Effect probably benign
Transcript: ENSMUST00000216838
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares 22% sequence identity with Hemophilus influenzae xylulokinase, and even higher identity to other gene products in C.elegans (45%) and yeast (31-35%), which are thought to belong to a family of enzymes that include fucokinase, gluconokinase, glycerokinase and xylulokinase. These proteins play important roles in energy metabolism. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Xylb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Xylb APN 9 119390483 nonsense probably null
R0330:Xylb UTSW 9 119381587 missense probably damaging 0.98
R0959:Xylb UTSW 9 119380025 missense possibly damaging 0.85
R1401:Xylb UTSW 9 119368067 splice site probably benign
R1417:Xylb UTSW 9 119364540 missense probably benign 0.04
R2315:Xylb UTSW 9 119359269 missense probably benign 0.22
R2322:Xylb UTSW 9 119388747 missense possibly damaging 0.95
R3884:Xylb UTSW 9 119380687 missense probably damaging 1.00
R4367:Xylb UTSW 9 119388715 missense probably benign 0.10
R4463:Xylb UTSW 9 119386367 missense probably benign 0.00
R4750:Xylb UTSW 9 119359313 nonsense probably null
R5181:Xylb UTSW 9 119364501 missense probably damaging 1.00
R5568:Xylb UTSW 9 119361132 missense probably benign 0.43
R6104:Xylb UTSW 9 119364507 makesense probably null
R6171:Xylb UTSW 9 119381591 missense probably damaging 1.00
R6642:Xylb UTSW 9 119367493 missense probably damaging 1.00
R6643:Xylb UTSW 9 119367493 missense probably damaging 1.00
R6836:Xylb UTSW 9 119391754 missense probably damaging 1.00
R7121:Xylb UTSW 9 119382292 missense probably benign 0.00
R7496:Xylb UTSW 9 119391816 makesense probably null
R7776:Xylb UTSW 9 119380700 critical splice donor site probably null
R7908:Xylb UTSW 9 119381545 missense probably benign 0.00
R7989:Xylb UTSW 9 119381545 missense probably benign 0.00
R8025:Xylb UTSW 9 119381503 missense probably damaging 0.99
Z1088:Xylb UTSW 9 119381614 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGACTTGGACACTCAGTCCCTCAC -3'
(R):5'- TGCTCTCTAAGGCACCTCAGTTGC -3'

Sequencing Primer
(F):5'- Tacacacacacacacacacac -3'
(R):5'- TAAGGCACCTCAGTTGCTTTCTC -3'
Posted On2014-01-05