Incidental Mutation 'R1127:Olfr323'
ID96321
Institutional Source Beutler Lab
Gene Symbol Olfr323
Ensembl Gene ENSMUSG00000043880
Gene Nameolfactory receptor 323
SynonymsMOR107-1, GA_x6K02T2NKPP-794386-795357
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1127 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58624159-58630501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58625458 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 196 (E196G)
Ref Sequence ENSEMBL: ENSMUSP00000151137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070804] [ENSMUST00000203173] [ENSMUST00000214132]
Predicted Effect probably damaging
Transcript: ENSMUST00000070804
AA Change: E196G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068147
Gene: ENSMUSG00000043880
AA Change: E196G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-54 PFAM
Pfam:7tm_1 41 290 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203173
SMART Domains Protein: ENSMUSP00000145459
Gene: ENSMUSG00000043880

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214132
AA Change: E196G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nxn A T 11: 76,274,069 C205* probably null Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Olfr323
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02995:Olfr323 APN 11 58625281 missense possibly damaging 0.92
IGL03118:Olfr323 APN 11 58625443 missense probably damaging 0.99
R0058:Olfr323 UTSW 11 58625668 missense probably damaging 1.00
R0335:Olfr323 UTSW 11 58625740 missense probably damaging 1.00
R2029:Olfr323 UTSW 11 58625493 missense probably damaging 1.00
R2434:Olfr323 UTSW 11 58625111 missense possibly damaging 0.95
R5483:Olfr323 UTSW 11 58625957 missense possibly damaging 0.95
R6423:Olfr323 UTSW 11 58625363 missense probably damaging 1.00
R6990:Olfr323 UTSW 11 58625458 missense probably damaging 0.98
R7472:Olfr323 UTSW 11 58625434 missense probably damaging 1.00
R7539:Olfr323 UTSW 11 58625956 missense probably damaging 1.00
R7635:Olfr323 UTSW 11 58625164 missense unknown
R7647:Olfr323 UTSW 11 58625203 missense probably damaging 1.00
R8519:Olfr323 UTSW 11 58625974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGTAGTAGATGGTGACCACAG -3'
(R):5'- TCCTTGCCGCAATGGCTTATGAC -3'

Sequencing Primer
(F):5'- ATGGTGACCACAGCCAGG -3'
(R):5'- TCATGAGCCCGGACAACTG -3'
Posted On2014-01-05