Incidental Mutation 'R1127:Nxn'
ID96323
Institutional Source Beutler Lab
Gene Symbol Nxn
Ensembl Gene ENSMUSG00000020844
Gene Namenucleoredoxin
Synonymsl11Jus13
MMRRC Submission 039200-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1127 (G1)
Quality Score156
Status Not validated
Chromosome11
Chromosomal Location76257198-76399140 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 76274069 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 205 (C205*)
Ref Sequence ENSEMBL: ENSMUSP00000021204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021204]
Predicted Effect probably null
Transcript: ENSMUST00000021204
AA Change: C205*
SMART Domains Protein: ENSMUSP00000021204
Gene: ENSMUSG00000020844
AA Change: C205*

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 30 145 5.4e-23 PFAM
Pfam:AhpC-TSA 173 290 4.7e-10 PFAM
Pfam:Thioredoxin_2 189 296 7.1e-11 PFAM
Pfam:Thioredoxin_8 193 287 3.7e-32 PFAM
Pfam:Thioredoxin_6 236 424 8.4e-9 PFAM
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.1%
  • 20x: 80.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin superfamily, a group of small, multifunctional redox-active proteins. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. The encoded protein acts a redox-dependent regulator of the Wnt signaling pathway and is involved in cell growth and differentiation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice die by P1 and exhibit craniofacial bone defects and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700088E04Rik T C 15: 79,135,203 D179G probably benign Het
Adh7 C T 3: 138,221,729 A12V probably benign Het
Ankhd1 T A 18: 36,634,346 N1179K probably damaging Het
Ankrd50 T C 3: 38,457,187 T344A probably benign Het
Aplf T C 6: 87,646,291 T269A probably benign Het
C87977 G A 4: 144,207,124 T471I probably damaging Het
Cavin4 T C 4: 48,663,637 S6P probably damaging Het
Ces2g T C 8: 104,967,462 probably null Het
Cyp2c66 A T 19: 39,163,368 N176Y probably damaging Het
Dnah3 T A 7: 119,923,030 D3980V probably damaging Het
Drc7 G T 8: 95,072,788 E530D probably damaging Het
Dst A G 1: 34,275,277 T6434A probably damaging Het
Dtx3l A G 16: 35,938,757 S41P possibly damaging Het
Eef1b2 G A 1: 63,179,457 probably null Het
Eml3 C T 19: 8,936,308 T43I probably damaging Het
Fam110b T A 4: 5,799,434 L284Q probably damaging Het
Gm5538 G A 3: 59,751,893 E256K probably benign Het
Gpr33 A C 12: 52,023,469 H262Q probably damaging Het
Igfals T G 17: 24,880,481 L182R probably damaging Het
Lamc1 A G 1: 153,250,459 F496L possibly damaging Het
Mgea5 G A 19: 45,752,155 R914* probably null Het
Muc4 T A 16: 32,750,525 H134Q possibly damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Olfr651 C A 7: 104,553,086 H56N possibly damaging Het
Pamr1 A T 2: 102,639,353 I415F possibly damaging Het
Ppp4r4 G A 12: 103,579,068 G200E probably damaging Het
Prdm16 C A 4: 154,528,799 S57I probably damaging Het
Psmd11 A G 11: 80,471,584 K157R possibly damaging Het
Ptprn2 G A 12: 117,212,008 probably null Het
Pus7 G A 5: 23,768,795 H234Y probably benign Het
Rd3l A G 12: 111,980,283 Y20H probably benign Het
Stk31 A G 6: 49,409,207 D160G probably damaging Het
Sycp2 C T 2: 178,374,366 E768K possibly damaging Het
Tango6 T C 8: 106,688,895 V116A probably benign Het
Ttn C T 2: 76,867,230 probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Xylb T C 9: 119,383,377 I427T probably damaging Het
Zc3h7a T G 16: 11,139,075 D890A probably damaging Het
Other mutations in Nxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nxn APN 11 76274655 splice site probably benign
IGL01780:Nxn APN 11 76274654 splice site probably benign
IGL02350:Nxn APN 11 76274654 splice site probably benign
IGL02357:Nxn APN 11 76274654 splice site probably benign
IGL02423:Nxn APN 11 76274032 missense probably benign 0.13
R0098:Nxn UTSW 11 76278594 splice site probably benign
R0456:Nxn UTSW 11 76263137 nonsense probably null
R1473:Nxn UTSW 11 76263187 missense possibly damaging 0.93
R1681:Nxn UTSW 11 76272464 missense probably benign 0.03
R1917:Nxn UTSW 11 76261672 splice site probably benign
R1918:Nxn UTSW 11 76261672 splice site probably benign
R2010:Nxn UTSW 11 76398801 missense probably damaging 0.99
R4501:Nxn UTSW 11 76274612 missense probably damaging 0.98
R4827:Nxn UTSW 11 76261592 missense probably benign 0.01
R5029:Nxn UTSW 11 76274530 nonsense probably null
R5078:Nxn UTSW 11 76261607 missense probably damaging 1.00
R6403:Nxn UTSW 11 76399020 missense probably benign 0.22
R7088:Nxn UTSW 11 76263148 missense possibly damaging 0.94
R7478:Nxn UTSW 11 76261552 missense probably damaging 0.97
R7642:Nxn UTSW 11 76272459 missense probably damaging 1.00
R7830:Nxn UTSW 11 76273993 missense probably damaging 1.00
X0062:Nxn UTSW 11 76263152 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGGCAAAGACACCTGTGTAAGCCG -3'
(R):5'- AGTAAATGCTCATGCTGCCAGTGAC -3'

Sequencing Primer
(F):5'- ACACCTGTGTAAGCCGTTACTG -3'
(R):5'- ATTTCTCAGGCTCCGAAAGG -3'
Posted On2014-01-05